Mutagenetix > Incidental Mutation

Incidental Mutation 'R5196:Chrna5'

400254

Institutional Source

Beutler Lab

Gene Symbol

Chrna5

Ensembl Gene

ENSMUSG00000035594

Gene Name

cholinergic receptor, nicotinic, alpha polypeptide 5

Synonyms

Acra-5, Acra5

MMRRC Submission

042772-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R5196 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54980880-55007779 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55006519 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 421 (I421V)

Ref Sequence

ENSEMBL: ENSMUSP00000091365 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034851] [ENSMUST00000093844] [ENSMUST00000213960] [ENSMUST00000217408]

AlphaFold

Q2MKA5

Predicted Effect

probably benign
Transcript: ENSMUST00000034851

SMART Domains

Protein: ENSMUSP00000034851
Gene: ENSMUSG00000032303

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:Neur_chan_LBD	34	240	6.1e-77	PFAM
Pfam:Neur_chan_memb	247	494	7.5e-95	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093844
AA Change: I421V

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000091365
Gene: ENSMUSG00000035594
AA Change: I421V

Domain	Start	End	E-Value	Type
Pfam:Neur_chan_LBD	18	221	4.9e-72	PFAM
Pfam:Neur_chan_memb	228	352	1.9e-51	PFAM
Pfam:Neur_chan_memb	338	417	1.2e-14	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213960
AA Change: I450V

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217408
AA Change: I346V

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.2398

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nicotinic acetylcholine receptor subunit and a member of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. These receptors are thought to be heteropentamers composed of separate but similar subunits. Defects in this gene have been linked to susceptibility to lung cancer type 2 (LNCR2).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are less sensitive to nicotine-induced seizures than wild-type controls and exhibit a significantly shorter latency time to seizure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,796,438	T281A	possibly damaging	Het
4930503B20Rik	A	G	3: 146,646,263		probably benign	Het
6330409D20Rik	T	A	2: 32,740,540		probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Amigo2	A	G	15: 97,246,061	F160S	probably damaging	Het
Arcn1	A	T	9: 44,760,027	L68M	probably damaging	Het
Arhgef25	A	G	10: 127,185,109	S303P	probably damaging	Het
Asph	A	T	4: 9,607,830	S163T	probably damaging	Het
BC003331	T	A	1: 150,382,389	D165V	probably damaging	Het
Birc6	T	C	17: 74,606,141		probably benign	Het
Ccm2	G	A	11: 6,561,181		probably benign	Het
Cdc42bpa	T	C	1: 180,072,413	V431A	probably benign	Het
Cdh7	T	A	1: 110,138,000	M668K	probably damaging	Het
Cfap43	A	T	19: 47,825,925	W157R	probably damaging	Het
Chrm5	T	C	2: 112,480,384	Y129C	probably damaging	Het
Clk1	T	A	1: 58,414,613	T301S	probably benign	Het
Col6a3	G	T	1: 90,816,538		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fam198a	T	G	9: 121,965,661	S294A	probably benign	Het
Fbxw19	T	C	9: 109,484,428	Y234C	probably benign	Het
Fgd4	T	A	16: 16,484,142	N183I	probably benign	Het
Fnip2	T	C	3: 79,572,538		probably benign	Het
Gm9847	T	A	12: 14,495,015		noncoding transcript	Het
H2-T23	A	G	17: 36,032,607		probably null	Het
Hdlbp	T	C	1: 93,420,193	E613G	probably damaging	Het
Kat6a	G	A	8: 22,911,713	R366H	probably damaging	Het
Kctd4	A	G	14: 75,962,687	T33A	probably benign	Het
Klrb1c	T	A	6: 128,780,299	S268C	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrfip1	A	G	1: 91,114,608	E245G	probably damaging	Het
Mast3	A	T	8: 70,788,245	I220N	probably damaging	Het
Mfap3	A	G	11: 57,529,813	T207A	probably damaging	Het
Mtdh	G	T	15: 34,118,004	K75N	probably damaging	Het
Mybpc1	A	G	10: 88,536,351	Y806H	probably damaging	Het
Ntng1	T	C	3: 109,934,983	D158G	probably damaging	Het
Olfr1176	A	G	2: 88,339,748	Y61C	possibly damaging	Het
Olfr812	T	A	10: 129,842,781	D87V	possibly damaging	Het
Pask	A	G	1: 93,310,083		probably benign	Het
Pif1	G	T	9: 65,588,092	A95S	probably benign	Het
Plppr2	T	C	9: 21,941,132	F104S	probably damaging	Het
Prmt9	G	A	8: 77,564,997	V333M	probably benign	Het
Pten	A	T	19: 32,815,497	M239L	probably benign	Het
Rb1cc1	A	G	1: 6,234,230	D67G	probably damaging	Het
Reg2	T	A	6: 78,405,547	L12*	probably null	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc5a7	C	A	17: 54,281,722		probably null	Het
Tcaf3	G	T	6: 42,593,715	R368S	probably benign	Het
Tfcp2	A	G	15: 100,520,714	V189A	probably damaging	Het
Uhrf1bp1	A	G	17: 27,856,763	I5V	probably benign	Het
Wdr12	T	C	1: 60,087,084	S191G	probably damaging	Het
Zfp536	G	A	7: 37,480,760	R807W	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Chrna5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01407:Chrna5	APN	9	55004399	missense	possibly damaging	0.61
IGL01503:Chrna5	APN	9	54998171	intron	probably benign
IGL01617:Chrna5	APN	9	55005013	missense	probably damaging	0.98
IGL01935:Chrna5	APN	9	55004843	missense	probably benign	0.01
IGL02613:Chrna5	APN	9	55006421	missense	probably damaging	0.99
IGL03248:Chrna5	APN	9	55004639	missense	probably damaging	1.00
IGL03412:Chrna5	APN	9	55004435	missense	probably damaging	1.00
R0712:Chrna5	UTSW	9	55004363	missense	probably damaging	1.00
R1619:Chrna5	UTSW	9	55004365	missense	probably benign	0.00
R1698:Chrna5	UTSW	9	55004642	missense	probably damaging	1.00
R1789:Chrna5	UTSW	9	55004651	missense	possibly damaging	0.94
R1800:Chrna5	UTSW	9	55004875	missense	probably damaging	0.99
R4028:Chrna5	UTSW	9	54998086	missense	probably damaging	1.00
R4030:Chrna5	UTSW	9	54998086	missense	probably damaging	1.00
R4031:Chrna5	UTSW	9	54998086	missense	probably damaging	1.00
R4201:Chrna5	UTSW	9	54998075	missense	probably benign	0.00
R4792:Chrna5	UTSW	9	55004701	missense	probably damaging	1.00
R5718:Chrna5	UTSW	9	54998105	missense	probably benign	0.00
R5779:Chrna5	UTSW	9	54998104	missense	probably benign	0.35
R6254:Chrna5	UTSW	9	55006456	missense	probably benign	0.00
R6492:Chrna5	UTSW	9	54998063	missense	probably benign	0.11
R6887:Chrna5	UTSW	9	55005133	missense	probably benign	0.00
R6986:Chrna5	UTSW	9	55006457	missense	possibly damaging	0.83
R7056:Chrna5	UTSW	9	54981701	intron	probably benign
R7222:Chrna5	UTSW	9	54998063	missense	probably benign	0.11
R7384:Chrna5	UTSW	9	55004833	missense	probably damaging	1.00
R7572:Chrna5	UTSW	9	55006465	missense	probably damaging	1.00
R7653:Chrna5	UTSW	9	55002434	missense	probably benign
R7846:Chrna5	UTSW	9	55005107	missense	probably benign	0.38
R8808:Chrna5	UTSW	9	54998064	missense	probably benign	0.20
R8901:Chrna5	UTSW	9	55004453	missense	probably damaging	1.00
R9303:Chrna5	UTSW	9	55004872	missense	probably benign	0.16
R9716:Chrna5	UTSW	9	55004635	missense	probably benign	0.00
Z1176:Chrna5	UTSW	9	55004482	missense	probably damaging	1.00
Z1177:Chrna5	UTSW	9	55004956	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- ATCTGGGCATAGGAGACAGC -3'
(R):5'- GACAGTGTTGGTACTCAAGGC -3'

Sequencing Primer
(F):5'- GGAGACAGCAAATGATTATCTCTCTG -3'
(R):5'- CAGTGTTGGTACTCAAGGCTATTAC -3'

Posted On

2016-07-06