Incidental Mutation 'R7049:Vmn2r4'
ID547473
Institutional Source Beutler Lab
Gene Symbol Vmn2r4
Ensembl Gene ENSMUSG00000092049
Gene Namevomeronasal 2, receptor 4
SynonymsEG637053
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7049 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location64388621-64415296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64389129 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 745 (G745D)
Ref Sequence ENSEMBL: ENSMUSP00000135228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170280] [ENSMUST00000175724]
Predicted Effect probably benign
Transcript: ENSMUST00000170280
AA Change: G656D

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127513
Gene: ENSMUSG00000092049
AA Change: G656D

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 2.7e-72 PFAM
Pfam:Peripla_BP_6 61 240 1.9e-9 PFAM
Pfam:NCD3G 458 511 1.1e-17 PFAM
Pfam:7tm_3 542 779 1.8e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175724
AA Change: G745D

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135228
Gene: ENSMUSG00000092049
AA Change: G745D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 2.3e-75 PFAM
Pfam:NCD3G 547 600 4.7e-17 PFAM
Pfam:7tm_3 633 867 8.2e-47 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik T C 6: 116,652,293 L199P probably damaging Het
Abca4 T C 3: 122,147,848 V447A probably benign Het
Adam6b A G 12: 113,490,502 D313G probably damaging Het
Adcy10 G T 1: 165,539,874 C571F probably damaging Het
Anxa1 A G 19: 20,375,271 V313A probably benign Het
Bpifb6 A T 2: 153,908,813 probably null Het
Cacna1c C A 6: 118,601,163 C1713F probably benign Het
Cep135 A G 5: 76,606,738 N354S probably benign Het
Cers2 A G 3: 95,321,654 D200G probably damaging Het
Cpne1 A G 2: 156,078,807 L133P probably damaging Het
Ddhd1 A G 14: 45,602,681 Y16H probably damaging Het
Fastkd2 T C 1: 63,731,850 F122L probably benign Het
Fastkd5 A T 2: 130,615,511 D386E probably damaging Het
Gm5134 T A 10: 75,992,458 C291S probably damaging Het
Gria2 T C 3: 80,689,327 S811G probably damaging Het
Hcn1 C T 13: 117,975,462 P654L unknown Het
Hrnr C A 3: 93,323,154 S233* probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Itgal A T 7: 127,296,401 probably benign Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Mical1 A G 10: 41,482,250 R420G possibly damaging Het
Mllt6 T A 11: 97,673,811 L481Q probably damaging Het
Mtdh T A 15: 34,131,165 N174K probably damaging Het
Nhsl1 A G 10: 18,531,638 M1507V probably damaging Het
Npm3 A T 19: 45,749,555 M1K probably null Het
Olfr380 C T 11: 73,453,604 G203R probably damaging Het
Pold1 A T 7: 44,541,371 W290R possibly damaging Het
Prss52 C T 14: 64,112,572 T216I probably damaging Het
Psme4 T C 11: 30,813,904 probably null Het
Pwwp2a T A 11: 43,706,191 F453I probably damaging Het
Rttn A G 18: 89,064,216 N1422S probably damaging Het
Scaf4 A C 16: 90,260,187 I92R unknown Het
Slc12a1 A G 2: 125,171,257 K345E probably benign Het
Slc22a28 A T 19: 8,071,905 N326K probably benign Het
Smgc A G 15: 91,860,378 E311G possibly damaging Het
Snx7 C T 3: 117,840,031 R90H possibly damaging Het
Tex101 A G 7: 24,668,258 I223T probably benign Het
Tnik A T 3: 28,661,704 K1093* probably null Het
Tnxb T G 17: 34,717,268 probably null Het
Trio T C 15: 27,749,799 N2272S possibly damaging Het
Tubal3 T C 13: 3,932,756 Y179H probably damaging Het
Vps9d1 A T 8: 123,247,143 Y300* probably null Het
Zfp646 T A 7: 127,880,027 C459S possibly damaging Het
Other mutations in Vmn2r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Vmn2r4 APN 3 64409779 splice site probably null
IGL01448:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01452:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01454:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01456:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01463:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01467:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01468:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01470:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01476:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01481:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01534:Vmn2r4 APN 3 64406423 missense probably damaging 1.00
IGL01636:Vmn2r4 APN 3 64406236 missense probably benign 0.21
IGL01879:Vmn2r4 APN 3 64391010 missense probably damaging 1.00
IGL02147:Vmn2r4 APN 3 64398361 splice site probably benign
IGL02276:Vmn2r4 APN 3 64406456 missense possibly damaging 0.95
IGL02432:Vmn2r4 APN 3 64406400 missense probably benign 0.38
IGL02533:Vmn2r4 APN 3 64398419 nonsense probably null
IGL02655:Vmn2r4 APN 3 64398465 missense probably damaging 0.97
IGL02666:Vmn2r4 APN 3 64389012 missense probably benign 0.10
IGL02902:Vmn2r4 APN 3 64406916 missense probably benign 0.22
IGL03189:Vmn2r4 APN 3 64389168 missense possibly damaging 0.89
IGL03250:Vmn2r4 APN 3 64406642 missense probably damaging 1.00
IGL03271:Vmn2r4 APN 3 64398429 missense probably benign 0.01
R0310:Vmn2r4 UTSW 3 64389434 nonsense probably null
R0504:Vmn2r4 UTSW 3 64389363 missense probably damaging 1.00
R1546:Vmn2r4 UTSW 3 64406888 missense probably damaging 1.00
R1562:Vmn2r4 UTSW 3 64389444 missense probably damaging 0.98
R1863:Vmn2r4 UTSW 3 64406989 missense probably benign 0.33
R1873:Vmn2r4 UTSW 3 64391058 missense possibly damaging 0.93
R1939:Vmn2r4 UTSW 3 64398555 missense probably benign 0.00
R2103:Vmn2r4 UTSW 3 64415283 missense possibly damaging 0.48
R3083:Vmn2r4 UTSW 3 64389367 missense probably damaging 1.00
R3687:Vmn2r4 UTSW 3 64389475 missense possibly damaging 0.93
R3707:Vmn2r4 UTSW 3 64389474 missense probably damaging 0.99
R3963:Vmn2r4 UTSW 3 64415151 missense probably damaging 0.99
R4428:Vmn2r4 UTSW 3 64415169 missense probably damaging 1.00
R4710:Vmn2r4 UTSW 3 64409780 critical splice donor site probably null
R4737:Vmn2r4 UTSW 3 64409963 missense probably damaging 1.00
R4767:Vmn2r4 UTSW 3 64390976 missense probably damaging 0.99
R4776:Vmn2r4 UTSW 3 64388661 missense probably damaging 0.96
R4834:Vmn2r4 UTSW 3 64410063 missense probably benign 0.40
R4893:Vmn2r4 UTSW 3 64406255 missense probably damaging 0.96
R4908:Vmn2r4 UTSW 3 64389055 missense possibly damaging 0.59
R5049:Vmn2r4 UTSW 3 64398598 splice site probably null
R5092:Vmn2r4 UTSW 3 64390952 missense probably benign 0.01
R5234:Vmn2r4 UTSW 3 64398457 missense possibly damaging 0.88
R5240:Vmn2r4 UTSW 3 64406937 missense possibly damaging 0.53
R5704:Vmn2r4 UTSW 3 64409949 missense probably benign 0.03
R5897:Vmn2r4 UTSW 3 64415266 nonsense probably null
R5907:Vmn2r4 UTSW 3 64391066 missense probably damaging 0.99
R5924:Vmn2r4 UTSW 3 64389264 missense probably damaging 1.00
R6145:Vmn2r4 UTSW 3 64406943 missense probably benign 0.00
R6191:Vmn2r4 UTSW 3 64415281 missense probably benign 0.34
R6192:Vmn2r4 UTSW 3 64415278 missense probably benign 0.00
R6207:Vmn2r4 UTSW 3 64406505 missense probably damaging 1.00
R6457:Vmn2r4 UTSW 3 64409957 missense probably damaging 1.00
R6533:Vmn2r4 UTSW 3 64415098 missense probably benign
R6545:Vmn2r4 UTSW 3 64406356 missense possibly damaging 0.50
R6594:Vmn2r4 UTSW 3 64389310 missense probably damaging 1.00
R7150:Vmn2r4 UTSW 3 64398477 missense probably benign 0.01
R7187:Vmn2r4 UTSW 3 64415260 missense probably benign 0.00
R7363:Vmn2r4 UTSW 3 64407011 missense probably damaging 1.00
R7477:Vmn2r4 UTSW 3 64398429 missense probably benign 0.01
R7675:Vmn2r4 UTSW 3 64415236 missense probably benign 0.01
R7858:Vmn2r4 UTSW 3 64409805 missense probably benign 0.00
R7888:Vmn2r4 UTSW 3 64406522 missense probably damaging 0.99
R7941:Vmn2r4 UTSW 3 64409805 missense probably benign 0.00
R7971:Vmn2r4 UTSW 3 64406522 missense probably damaging 0.99
X0019:Vmn2r4 UTSW 3 64406636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAATAGTTATCTGGCAGCTGGC -3'
(R):5'- GTTGTTCATAGGCAAGCCATG -3'

Sequencing Primer
(F):5'- CTGGCGAGCCACAAAGGTG -3'
(R):5'- TGCAACTGGTCCTGCAAGAC -3'
Posted On2019-05-13