Incidental Mutation 'R0582:Prpf40a'
ID56450
Institutional Source Beutler Lab
Gene Symbol Prpf40a
Ensembl Gene ENSMUSG00000061136
Gene Namepre-mRNA processing factor 40A
SynonymsFnbp3, FBP11, 2810012K09Rik
MMRRC Submission 038772-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0582 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location53134704-53191284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53145692 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 695 (F695L)
Ref Sequence ENSEMBL: ENSMUSP00000075655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076313] [ENSMUST00000209364] [ENSMUST00000210789] [ENSMUST00000211712]
Predicted Effect probably damaging
Transcript: ENSMUST00000076313
AA Change: F695L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075655
Gene: ENSMUSG00000061136
AA Change: F695L

DomainStartEndE-ValueType
low complexity region 77 124 N/A INTRINSIC
WW 141 173 7.54e-13 SMART
WW 182 214 1.57e-10 SMART
low complexity region 272 294 N/A INTRINSIC
FF 389 443 1.32e-17 SMART
FF 456 515 4.22e1 SMART
FF 523 583 1.11e-10 SMART
FF 603 663 4.31e0 SMART
low complexity region 670 682 N/A INTRINSIC
FF 739 795 7.43e-12 SMART
low complexity region 802 879 N/A INTRINSIC
low complexity region 883 923 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133384
Predicted Effect probably damaging
Transcript: ENSMUST00000209364
AA Change: F668L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000210789
AA Change: F653L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000211712
Meta Mutation Damage Score 0.2947 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,125,082 noncoding transcript Het
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Arfgef3 G A 10: 18,611,290 A1332V probably damaging Het
Atp11a T C 8: 12,831,214 S451P probably benign Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnna2 C A 6: 77,758,417 V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Ears2 T C 7: 122,055,658 E129G probably benign Het
Gm4981 A T 10: 58,235,686 S235R probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Ipp T C 4: 116,515,467 L231S probably damaging Het
Lyn T A 4: 3,743,296 L72Q probably damaging Het
Nfe2l2 T A 2: 75,676,768 E329D probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pdyn A C 2: 129,689,738 L44R probably damaging Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Sema6c C T 3: 95,169,197 R265C probably damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snap47 A T 11: 59,428,433 L293* probably null Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in Prpf40a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Prpf40a APN 2 53150688 missense probably benign 0.00
IGL00533:Prpf40a APN 2 53145343 missense probably damaging 1.00
IGL01099:Prpf40a APN 2 53141835 missense probably benign 0.00
IGL02039:Prpf40a APN 2 53144803 missense probably damaging 1.00
IGL02608:Prpf40a APN 2 53146153 missense probably damaging 0.97
I1329:Prpf40a UTSW 2 53176395 missense probably benign 0.01
R0284:Prpf40a UTSW 2 53150647 missense probably damaging 1.00
R0401:Prpf40a UTSW 2 53159313 missense probably damaging 0.99
R0544:Prpf40a UTSW 2 53141651 unclassified probably benign
R1533:Prpf40a UTSW 2 53145840 missense probably damaging 1.00
R2057:Prpf40a UTSW 2 53144839 missense probably damaging 1.00
R4274:Prpf40a UTSW 2 53146172 missense probably damaging 1.00
R4604:Prpf40a UTSW 2 53142023 missense probably damaging 0.99
R4814:Prpf40a UTSW 2 53190020 missense probably damaging 1.00
R4976:Prpf40a UTSW 2 53144849 missense probably damaging 1.00
R5119:Prpf40a UTSW 2 53144849 missense probably damaging 1.00
R5378:Prpf40a UTSW 2 53145876 missense probably damaging 1.00
R5448:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5449:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5450:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5500:Prpf40a UTSW 2 53145284 missense probably benign 0.03
R5637:Prpf40a UTSW 2 53156734 missense possibly damaging 0.59
R6052:Prpf40a UTSW 2 53159281 missense probably benign 0.41
R6149:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6150:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6151:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6162:Prpf40a UTSW 2 53159305 missense probably benign 0.01
R6199:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6200:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6207:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6254:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6266:Prpf40a UTSW 2 53156627 missense probably benign 0.17
R6394:Prpf40a UTSW 2 53144878 missense probably damaging 1.00
R6603:Prpf40a UTSW 2 53152963 missense probably damaging 0.96
R6606:Prpf40a UTSW 2 53151751 missense probably damaging 0.99
R6641:Prpf40a UTSW 2 53141626 unclassified probably benign
R6929:Prpf40a UTSW 2 53144863 missense possibly damaging 0.95
R7158:Prpf40a UTSW 2 53152553 missense probably damaging 0.99
R7401:Prpf40a UTSW 2 53156947 missense probably benign 0.01
R7675:Prpf40a UTSW 2 53145636 missense possibly damaging 0.89
R7750:Prpf40a UTSW 2 53151745 missense probably damaging 1.00
R7893:Prpf40a UTSW 2 53156841 missense probably benign 0.24
R7976:Prpf40a UTSW 2 53156841 missense probably benign 0.24
R8027:Prpf40a UTSW 2 53191138 missense probably benign 0.01
X0060:Prpf40a UTSW 2 53145664 missense probably damaging 0.96
Z1176:Prpf40a UTSW 2 53144875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGGCTTCTGCCTTTTCTAGTAAC -3'
(R):5'- CAGCCGGGTGAGATTCCTTTCTTTC -3'

Sequencing Primer
(F):5'- GATGAGTCCTGTTTCAAACAAGAC -3'
(R):5'- TCCAAGCATACCTTAGGAGTTG -3'
Posted On2013-07-11