Incidental Mutation 'R7308:Nsd3'
ID567394
Institutional Source Beutler Lab
Gene Symbol Nsd3
Ensembl Gene ENSMUSG00000054823
Gene Namenuclear receptor binding SET domain protein 3
SynonymsWhsc1l1, WHISTLE
MMRRC Submission
Accession Numbers

Genbank: NM_001081269, NM_001001735.1; MGI: 2142581; Ensemb: ENSMUST00000155861, ENSMUST00000146919, ENSMUST00000142395, ENSMUST00000139966, ENSMUST00000153597, ENSMUST00000084026, ENSMUST0000017135

Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R7308 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location25601601-25719667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25640724 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 35 (D35V)
Ref Sequence ENSEMBL: ENSMUSP00000117596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084026] [ENSMUST00000136107] [ENSMUST00000139966] [ENSMUST00000142395] [ENSMUST00000143445] [ENSMUST00000146919] [ENSMUST00000155861]
Predicted Effect probably damaging
Transcript: ENSMUST00000084026
AA Change: D35V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823
AA Change: D35V

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136107
AA Change: D35V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000139966
AA Change: D35V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122096
Gene: ENSMUSG00000054823
AA Change: D35V

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 914 5.24e-8 SMART
PWWP 919 981 8.62e-18 SMART
AWS 1054 1105 2.61e-17 SMART
SET 1106 1229 2.17e-41 SMART
PostSET 1230 1246 2.63e-3 SMART
low complexity region 1260 1277 N/A INTRINSIC
PHD 1283 1326 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142395
AA Change: D35V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823
AA Change: D35V

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143445
AA Change: D35V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000146919
AA Change: D35V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115470
Gene: ENSMUSG00000054823
AA Change: D35V

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
Pfam:PWWP 278 388 1.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155861
AA Change: D35V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117596
Gene: ENSMUSG00000054823
AA Change: D35V

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
Pfam:PWWP 278 388 1.6e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the SET domain family of histone lysine N-methyltransferase proteins. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. It acts in opposition to the histone demethylase Jmjd1c. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,423,770 I43T probably benign Het
Ankar G A 1: 72,651,794 Q1175* probably null Het
Aqr G A 2: 114,104,062 A1366V possibly damaging Het
Arhgap45 G A 10: 80,026,558 probably null Het
Atf7ip T A 6: 136,565,089 M607K probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,152 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Bcar3 T A 3: 122,508,493 V279E probably benign Het
Cd96 C T 16: 46,071,734 probably null Het
Cdca2 G A 14: 67,694,991 P488S probably benign Het
Col4a2 T G 8: 11,406,856 probably null Het
Cyp4a12a A G 4: 115,327,758 R379G possibly damaging Het
Defb34 A G 8: 19,126,379 S29G probably benign Het
Dnah11 A G 12: 117,995,275 S2958P probably damaging Het
Dync1h1 A G 12: 110,665,162 D4431G possibly damaging Het
Egfem1 A T 3: 29,151,866 H84L probably benign Het
Enah A T 1: 181,906,385 probably null Het
Fam178b G T 1: 36,659,407 Q78K probably benign Het
Glb1 A G 9: 114,473,863 N589S probably damaging Het
Gm1527 C T 3: 28,902,280 H132Y probably benign Het
Gm4788 A G 1: 139,754,303 V185A possibly damaging Het
Gm4858 A G 3: 93,074,565 T223A probably benign Het
Gm5799 A G 14: 43,543,707 R22G possibly damaging Het
Grip2 T C 6: 91,778,688 D617G possibly damaging Het
Hax1 A T 3: 89,998,566 D5E possibly damaging Het
Hic1 A G 11: 75,167,151 L304P probably damaging Het
Hmox1 T A 8: 75,097,019 I105N probably damaging Het
Hormad1 T C 3: 95,562,555 S38P probably damaging Het
Hspa4 A G 11: 53,267,103 S558P possibly damaging Het
Kcnf1 T A 12: 17,174,729 H497L probably benign Het
Kcnma1 C T 14: 23,330,935 D1022N probably damaging Het
Kcnt1 T C 2: 25,900,463 F479S possibly damaging Het
Krba1 T C 6: 48,406,339 V203A probably benign Het
Lct G T 1: 128,319,087 P233Q probably benign Het
Ly75 T C 2: 60,334,515 D773G probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Man1a2 A T 3: 100,620,105 L333Q probably damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Myof A T 19: 37,910,911 S1800R probably damaging Het
Nbea A C 3: 56,091,031 C118W probably damaging Het
Olfr1386 G A 11: 49,469,927 probably benign Het
Olfr739 G A 14: 50,425,265 V249I possibly damaging Het
Pcnx3 C T 19: 5,686,147 R217H possibly damaging Het
Pcsk4 G A 10: 80,323,173 P462L probably benign Het
Pdia5 T G 16: 35,456,509 K96N probably damaging Het
Pik3c2a T C 7: 116,373,839 Y707C probably damaging Het
Ppig A T 2: 69,749,462 N447Y unknown Het
Ppp1r9b T C 11: 95,004,571 L695P possibly damaging Het
Proser1 C T 3: 53,478,704 A669V probably benign Het
Rdx A T 9: 52,068,870 K254N probably damaging Het
Slc35f2 T C 9: 53,798,010 S95P probably benign Het
Slc4a3 T A 1: 75,557,362 S1118T probably benign Het
Slf1 G A 13: 77,051,168 P698L probably benign Het
Sptbn2 A G 19: 4,751,574 E2338G probably benign Het
Taok3 T A 5: 117,200,151 Y91* probably null Het
Tbc1d31 C T 15: 57,952,816 L649F probably damaging Het
Tmem132b A T 5: 125,787,646 I939F possibly damaging Het
Trav17 T A 14: 53,806,979 Y69N probably benign Het
Trmt13 T C 3: 116,594,739 D16G probably benign Het
Upf2 T A 2: 5,973,518 Y398N unknown Het
Vmn1r238 T C 18: 3,122,875 T180A probably benign Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zfp738 A T 13: 67,669,553 I773N probably benign Het
Zscan4e A T 7: 11,307,153 M264K probably benign Het
Other mutations in Nsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Nsd3 APN 8 25676712 missense probably benign 0.40
IGL00718:Nsd3 APN 8 25706534 missense probably damaging 0.97
IGL00727:Nsd3 APN 8 25641158 missense probably damaging 1.00
IGL01324:Nsd3 APN 8 25662820 missense probably damaging 1.00
IGL01614:Nsd3 APN 8 25666079 missense possibly damaging 0.65
IGL01834:Nsd3 APN 8 25640652 missense probably damaging 1.00
IGL02066:Nsd3 APN 8 25713488 missense probably damaging 1.00
IGL02229:Nsd3 APN 8 25710748 missense probably damaging 0.98
IGL02481:Nsd3 APN 8 25691116 missense probably damaging 1.00
IGL02686:Nsd3 APN 8 25666070 missense probably damaging 0.96
IGL03394:Nsd3 APN 8 25675749 splice site probably benign
Pine UTSW 8 25679936 missense possibly damaging 0.87
D3080:Nsd3 UTSW 8 25713545 missense possibly damaging 0.77
IGL02802:Nsd3 UTSW 8 25640906 missense probably damaging 1.00
R0136:Nsd3 UTSW 8 25659854 nonsense probably null
R0195:Nsd3 UTSW 8 25680693 missense probably damaging 1.00
R0207:Nsd3 UTSW 8 25683257 missense probably benign 0.02
R0471:Nsd3 UTSW 8 25648434 splice site probably benign
R0511:Nsd3 UTSW 8 25678716 missense possibly damaging 0.81
R0524:Nsd3 UTSW 8 25700577 missense possibly damaging 0.90
R0581:Nsd3 UTSW 8 25710691 missense probably damaging 1.00
R0589:Nsd3 UTSW 8 25641287 missense probably damaging 1.00
R0645:Nsd3 UTSW 8 25709069 missense probably benign 0.08
R0664:Nsd3 UTSW 8 25714240 missense probably damaging 0.97
R0738:Nsd3 UTSW 8 25678709 splice site probably null
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1265:Nsd3 UTSW 8 25682562 missense probably benign
R1298:Nsd3 UTSW 8 25679936 missense possibly damaging 0.87
R1424:Nsd3 UTSW 8 25700566 missense probably damaging 1.00
R1493:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1528:Nsd3 UTSW 8 25698767 missense probably damaging 1.00
R2051:Nsd3 UTSW 8 25691089 missense probably damaging 0.99
R2199:Nsd3 UTSW 8 25666057 missense probably damaging 0.99
R3414:Nsd3 UTSW 8 25700019 missense probably damaging 1.00
R3522:Nsd3 UTSW 8 25706614 missense probably benign
R3623:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3624:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3798:Nsd3 UTSW 8 25698845 missense probably damaging 1.00
R4345:Nsd3 UTSW 8 25641317 missense probably benign 0.04
R4370:Nsd3 UTSW 8 25648508 missense probably benign 0.13
R4421:Nsd3 UTSW 8 25641272 missense probably damaging 0.99
R4583:Nsd3 UTSW 8 25710676 missense probably benign 0.20
R4664:Nsd3 UTSW 8 25698866 missense probably damaging 1.00
R4741:Nsd3 UTSW 8 25673366 missense probably damaging 1.00
R4876:Nsd3 UTSW 8 25691134 missense possibly damaging 0.94
R4888:Nsd3 UTSW 8 25698911 missense probably damaging 1.00
R5000:Nsd3 UTSW 8 25682577 missense probably damaging 1.00
R5132:Nsd3 UTSW 8 25678839 missense possibly damaging 0.73
R5632:Nsd3 UTSW 8 25679969 missense probably benign 0.00
R5760:Nsd3 UTSW 8 25659756 missense probably damaging 1.00
R5778:Nsd3 UTSW 8 25659818 missense probably damaging 1.00
R5779:Nsd3 UTSW 8 25682669 nonsense probably null
R5860:Nsd3 UTSW 8 25666091 missense probably damaging 0.98
R5911:Nsd3 UTSW 8 25666076 missense probably damaging 1.00
R6168:Nsd3 UTSW 8 25691161 missense probably null 1.00
R6467:Nsd3 UTSW 8 25640630 missense probably damaging 1.00
R6490:Nsd3 UTSW 8 25714185 missense probably damaging 1.00
R6519:Nsd3 UTSW 8 25662939 missense probably damaging 1.00
R6554:Nsd3 UTSW 8 25662875 missense probably damaging 0.99
R7038:Nsd3 UTSW 8 25641263 missense probably damaging 1.00
R7088:Nsd3 UTSW 8 25666034 missense probably benign 0.40
R7244:Nsd3 UTSW 8 25666039 missense probably damaging 0.96
R7678:Nsd3 UTSW 8 25659817 missense possibly damaging 0.82
R7717:Nsd3 UTSW 8 25682562 missense probably benign
R8064:Nsd3 UTSW 8 25700670 nonsense probably null
X0026:Nsd3 UTSW 8 25700593 missense probably damaging 1.00
Z1088:Nsd3 UTSW 8 25641002 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AAGAGCTTGTATAATCCTTGGTTGG -3'
(R):5'- CATTGGGATACTGATTATATGGCGG -3'

Sequencing Primer
(F):5'- ATAATCCTTGGTTGGCTTCTTGC -3'
(R):5'- ATACTGATTATATGGCGGGTATTTGG -3'
Posted On2019-06-26