Incidental Mutation 'R7329:Myh10'
ID569132
Institutional Source Beutler Lab
Gene Symbol Myh10
Ensembl Gene ENSMUSG00000020900
Gene Namemyosin, heavy polypeptide 10, non-muscle
SynonymsMyosin IIB, Fltn, Fltn, Myhn-2, myosin IIB, nonmuscle myosin heavy chain II-B, NMHC-B, Myhn2, SMemb, NMHC II-B, 5730504C04Rik, nonmuscle myosin heavy chain IIB, 9330167F11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7329 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location68691559-68816632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68810191 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1742 (H1742R)
Ref Sequence ENSEMBL: ENSMUSP00000090661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018887] [ENSMUST00000092984] [ENSMUST00000102611]
Predicted Effect probably benign
Transcript: ENSMUST00000018887
AA Change: H1736R

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000018887
Gene: ENSMUSG00000020900
AA Change: H1736R

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.5e-15 PFAM
MYSc 79 815 N/A SMART
IQ 816 838 4.81e-4 SMART
low complexity region 932 946 N/A INTRINSIC
low complexity region 984 994 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1070 1086 N/A INTRINSIC
Pfam:Myosin_tail_1 1104 1961 6.5e-211 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092984
AA Change: H1742R

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090661
Gene: ENSMUSG00000020900
AA Change: H1742R

DomainStartEndE-ValueType
Pfam:Myosin_N 70 110 2.5e-13 PFAM
MYSc 116 821 N/A SMART
IQ 822 844 4.81e-4 SMART
Pfam:Myosin_tail_1 885 1965 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102611
AA Change: H1705R

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099671
Gene: ENSMUSG00000020900
AA Change: H1705R

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.4e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 4.81e-4 SMART
low complexity region 901 915 N/A INTRINSIC
low complexity region 953 963 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1039 1055 N/A INTRINSIC
Pfam:Myosin_tail_1 1073 1930 6.2e-211 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Nullizygous mice show pre- and neonatal death, heart defects and hydrocephaly. Deletion of exon B1 disrupts migration of facial neurons, whereas deletion of exon B2 leads to Purkinje cell anomalies. Hypomorphs show hydrocephaly and defects in motor control, cerebellar foliation and neuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,789,222 E52G probably damaging Het
Actb T C 5: 142,904,391 N252S probably benign Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
Ahnak A G 19: 9,001,792 T147A probably damaging Het
Ankfy1 T C 11: 72,712,208 V21A probably damaging Het
Arrdc4 T A 7: 68,741,027 N322Y probably damaging Het
Bfsp2 C A 9: 103,449,922 E205D probably benign Het
C2cd4b T A 9: 67,760,137 S138R possibly damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Ckap2l T A 2: 129,285,364 Q298L possibly damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cntnap2 G A 6: 47,271,271 V1204M possibly damaging Het
Col4a1 C T 8: 11,226,494 probably null Het
Ctrc T C 4: 141,843,711 T73A probably benign Het
Cubn A G 2: 13,468,771 F454L probably damaging Het
Cuedc1 A T 11: 88,169,866 S12C unknown Het
Cyb561a3 G T 19: 10,587,904 G211C probably damaging Het
D5Ertd579e A T 5: 36,616,395 S219T probably benign Het
Dennd4c C T 4: 86,779,874 P200S possibly damaging Het
Dennd4c T A 4: 86,841,081 Y1783N probably damaging Het
Dnah6 G A 6: 73,144,722 Q1426* probably null Het
Dync2h1 T G 9: 7,011,247 T3649P probably benign Het
E2f8 T C 7: 48,872,110 S415G probably damaging Het
Fbxo22 A G 9: 55,214,977 I147V probably benign Het
Gclc A G 9: 77,776,191 Y110C probably damaging Het
Gm15922 G A 7: 3,739,876 probably benign Het
Gstm5 A G 3: 107,896,331 T27A possibly damaging Het
Heatr4 A G 12: 83,978,082 S322P probably benign Het
Htt T A 5: 34,829,755 I1106N probably benign Het
Hunk T C 16: 90,386,682 V76A probably benign Het
Igkv12-98 C T 6: 68,571,103 T72I possibly damaging Het
Igkv9-123 A T 6: 67,954,645 W16R possibly damaging Het
Ipo7 T C 7: 110,049,017 L674S possibly damaging Het
Kcnh6 T C 11: 106,017,377 F273S probably benign Het
Lamb3 C A 1: 193,320,540 Q98K possibly damaging Het
Lingo4 A T 3: 94,402,855 T367S probably benign Het
Lypd6b A T 2: 49,942,500 I26F probably benign Het
Maneal T C 4: 124,856,719 T415A probably benign Het
Mapk1ip1l A G 14: 47,310,463 T23A unknown Het
Mrps17 T A 5: 129,716,641 probably benign Het
Mup13 T G 4: 61,227,689 D45A probably damaging Het
Mycbpap T A 11: 94,509,247 D408V probably damaging Het
Mylk4 A G 13: 32,716,783 Y255H probably damaging Het
Nbeal1 A G 1: 60,217,196 Q200R probably benign Het
Nkain2 TTTACTCGTT TTT 10: 32,889,896 probably null Het
Olfm4 T C 14: 80,011,929 V162A possibly damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr251 C A 9: 38,378,160 T87K probably benign Het
Olfr344 A G 2: 36,568,696 T33A probably benign Het
Olfr570 T C 7: 102,900,832 L155P probably damaging Het
Ovol3 T A 7: 30,235,252 R43S probably benign Het
Pcbp1 A G 6: 86,525,116 V267A probably benign Het
Phf20 T A 2: 156,304,632 V903E probably damaging Het
Pi4k2b T G 5: 52,756,869 S316A probably benign Het
Pkhd1 A T 1: 20,547,519 H947Q probably damaging Het
Ppip5k2 A C 1: 97,750,753 probably null Het
Prkca T A 11: 108,014,277 T212S possibly damaging Het
Psg16 A T 7: 17,090,686 I41F possibly damaging Het
Rae1 T A 2: 173,009,445 F204I probably benign Het
Rasef T A 4: 73,744,137 N192I probably damaging Het
Rfc1 T A 5: 65,263,135 R1122S unknown Het
Rfx2 A T 17: 56,803,681 S102T probably benign Het
Sez6l A G 5: 112,440,907 Y647H probably damaging Het
Siglecf A G 7: 43,351,971 Y121C probably damaging Het
Slc27a5 T C 7: 12,991,162 T453A possibly damaging Het
Slc44a2 G A 9: 21,342,752 R171Q probably damaging Het
Slc4a9 A C 18: 36,540,821 E889A possibly damaging Het
Snx31 C A 15: 36,555,476 R13L probably benign Het
Spag6l A T 16: 16,767,019 Y422N probably benign Het
Sulf2 T C 2: 166,117,088 T67A probably damaging Het
Syne2 G A 12: 75,966,984 R2983Q probably benign Het
Tmtc3 A G 10: 100,447,419 I758T probably benign Het
Top2a T A 11: 99,004,246 I843L possibly damaging Het
Tph1 T C 7: 46,656,861 probably null Het
Trdmt1 A G 2: 13,516,122 L323P probably damaging Het
Ush2a A T 1: 188,553,198 E1977V probably damaging Het
Utp4 A G 8: 106,913,463 E468G probably benign Het
Uts2r A G 11: 121,160,732 T141A possibly damaging Het
Vmn1r230 A G 17: 20,846,690 Y47C probably damaging Het
Other mutations in Myh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myh10 APN 11 68790708 missense probably benign 0.10
IGL01132:Myh10 APN 11 68768268 missense possibly damaging 0.93
IGL01348:Myh10 APN 11 68811803 missense probably benign 0.04
IGL01404:Myh10 APN 11 68752040 splice site probably null
IGL01409:Myh10 APN 11 68807219 missense probably damaging 0.98
IGL01660:Myh10 APN 11 68785889 missense probably benign 0.00
IGL02111:Myh10 APN 11 68790112 missense probably damaging 1.00
IGL02481:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02483:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02502:Myh10 APN 11 68814372 splice site probably null
IGL03178:Myh10 APN 11 68699413 missense probably benign 0.19
algia UTSW 11 68802931 missense probably damaging 1.00
itis UTSW 11 68764245 missense probably damaging 0.96
PIT4802001:Myh10 UTSW 11 68765092 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0517:Myh10 UTSW 11 68811599 critical splice acceptor site probably null
R0855:Myh10 UTSW 11 68811801 missense possibly damaging 0.88
R1110:Myh10 UTSW 11 68791850 splice site probably benign
R1135:Myh10 UTSW 11 68807197 missense probably benign
R1169:Myh10 UTSW 11 68762841 missense probably damaging 0.99
R1643:Myh10 UTSW 11 68792010 missense probably damaging 0.96
R1733:Myh10 UTSW 11 68802296 missense probably benign 0.06
R1754:Myh10 UTSW 11 68813058 missense probably damaging 0.98
R1859:Myh10 UTSW 11 68745413 missense probably benign 0.03
R1898:Myh10 UTSW 11 68771906 missense probably damaging 1.00
R1905:Myh10 UTSW 11 68771868 splice site probably benign
R1914:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1915:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1987:Myh10 UTSW 11 68814496 missense possibly damaging 0.56
R2130:Myh10 UTSW 11 68807289 splice site probably benign
R2132:Myh10 UTSW 11 68807289 splice site probably benign
R2136:Myh10 UTSW 11 68804714 missense probably damaging 1.00
R2214:Myh10 UTSW 11 68783127 missense probably damaging 1.00
R2351:Myh10 UTSW 11 68793139 missense probably damaging 1.00
R3407:Myh10 UTSW 11 68790211 missense possibly damaging 0.68
R3721:Myh10 UTSW 11 68813052 missense probably damaging 0.99
R3908:Myh10 UTSW 11 68771059 critical splice donor site probably null
R4275:Myh10 UTSW 11 68751940 critical splice acceptor site probably null
R4526:Myh10 UTSW 11 68815049 missense probably benign 0.04
R4666:Myh10 UTSW 11 68801730 critical splice donor site probably null
R4668:Myh10 UTSW 11 68804642 missense probably damaging 1.00
R4750:Myh10 UTSW 11 68785314 missense probably damaging 1.00
R4968:Myh10 UTSW 11 68793223 missense probably damaging 1.00
R4977:Myh10 UTSW 11 68798371 missense possibly damaging 0.55
R5201:Myh10 UTSW 11 68783195 missense probably damaging 1.00
R5288:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5304:Myh10 UTSW 11 68764245 missense probably damaging 0.96
R5366:Myh10 UTSW 11 68760692 missense probably damaging 0.97
R5384:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5427:Myh10 UTSW 11 68802931 missense probably damaging 1.00
R5546:Myh10 UTSW 11 68798380 missense possibly damaging 0.90
R5551:Myh10 UTSW 11 68768287 missense possibly damaging 0.65
R5777:Myh10 UTSW 11 68785859 missense probably damaging 1.00
R5995:Myh10 UTSW 11 68814983 missense probably benign 0.01
R6021:Myh10 UTSW 11 68808862 missense possibly damaging 0.72
R6171:Myh10 UTSW 11 68791890 missense probably damaging 1.00
R6179:Myh10 UTSW 11 68802153 missense probably damaging 0.98
R6263:Myh10 UTSW 11 68810232 missense probably damaging 0.98
R6264:Myh10 UTSW 11 68745415 missense probably benign 0.01
R6484:Myh10 UTSW 11 68699467 missense probably damaging 1.00
R6575:Myh10 UTSW 11 68808850 missense probably benign 0.00
R6736:Myh10 UTSW 11 68745339 missense probably damaging 1.00
R7141:Myh10 UTSW 11 68802139 missense probably benign
R7256:Myh10 UTSW 11 68790689 missense probably damaging 1.00
R7363:Myh10 UTSW 11 68815048 missense probably benign
R7576:Myh10 UTSW 11 68802166 missense probably damaging 1.00
R7577:Myh10 UTSW 11 68745980 missense unknown
R7681:Myh10 UTSW 11 68771936 missense probably damaging 0.98
X0028:Myh10 UTSW 11 68793135 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGACAGTGAAGCGCTTCC -3'
(R):5'- GGATGCCCAGACTTCTTGTC -3'

Sequencing Primer
(F):5'- AAGCGCTTCCTTGGTGGC -3'
(R):5'- CCTTTTAGACCTGAAGAGATGAGC -3'
Posted On2019-09-13