Incidental Mutation 'R7492:Megf10'
ID 580887
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Name multiple EGF-like-domains 10
Synonyms 3000002B06Rik, LOC240312
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R7492 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 57133090-57297467 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57291794 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1002 (Y1002H)
Ref Sequence ENSEMBL: ENSMUSP00000075174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
AlphaFold Q6DIB5
Predicted Effect probably benign
Transcript: ENSMUST00000075770
AA Change: Y1002H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: Y1002H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139892
AA Change: Y1002H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: Y1002H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,064,359 D819G possibly damaging Het
A830010M20Rik G A 5: 107,510,507 E1648K probably benign Het
Abca13 A T 11: 9,293,167 I1677L probably benign Het
Ablim2 A G 5: 35,841,329 S367G probably benign Het
Afdn G C 17: 13,848,376 probably null Het
Aldh6a1 A G 12: 84,436,866 L302P probably damaging Het
Ank3 A G 10: 69,882,527 D536G unknown Het
Ankrd17 A G 5: 90,233,948 V2454A possibly damaging Het
Apol7e G A 15: 77,717,456 E85K possibly damaging Het
Atmin A G 8: 116,956,918 D439G probably damaging Het
AU040320 G T 4: 126,847,855 C952F possibly damaging Het
BC055324 A G 1: 163,959,328 I724T probably benign Het
C6 A G 15: 4,731,714 S19G probably benign Het
Ccdc180 A T 4: 45,930,009 probably null Het
Cntn1 A C 15: 92,314,542 T862P probably benign Het
Col5a1 T C 2: 27,969,800 probably null Het
D430041D05Rik T C 2: 104,201,305 K964E probably damaging Het
Dnajc18 T C 18: 35,686,793 Y145C probably damaging Het
Dsc1 C T 18: 20,107,680 C196Y possibly damaging Het
Efcab11 A C 12: 99,878,401 I58R possibly damaging Het
Fam81b T A 13: 76,271,279 I51F probably benign Het
Fbln1 G A 15: 85,227,061 V139M probably damaging Het
Fbxw25 A G 9: 109,664,530 probably null Het
Fech C T 18: 64,467,771 W220* probably null Het
Fgl1 C T 8: 41,191,587 W293* probably null Het
Foxi2 T C 7: 135,410,572 L63P probably damaging Het
Frmpd1 A G 4: 45,285,237 R1353G possibly damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Galnt5 T A 2: 58,026,036 probably null Het
Glb1 A T 9: 114,473,949 I618F probably damaging Het
Gm13083 C A 4: 143,616,174 Q284K not run Het
Hs2st1 A T 3: 144,435,596 M237K probably benign Het
Ighm T C 12: 113,422,673 D19G Het
Il1f10 A G 2: 24,292,817 D35G probably benign Het
Itpr2 G A 6: 146,390,938 T419I probably damaging Het
Khdc1a A T 1: 21,350,318 E54V possibly damaging Het
Kif19a A G 11: 114,790,239 D991G probably benign Het
Klhl18 A C 9: 110,428,775 Y532* probably null Het
Lama1 T C 17: 67,817,651 F2902S Het
Lrba T C 3: 86,664,528 S2380P probably damaging Het
Lrp2 T A 2: 69,537,581 I196F probably damaging Het
Macf1 T C 4: 123,475,731 K1746E possibly damaging Het
Megf8 A G 7: 25,353,848 T1815A probably benign Het
Mtg1 T C 7: 140,144,697 L162P probably damaging Het
Myo6 T A 9: 80,288,046 Y899* probably null Het
Nlrp9a A T 7: 26,557,656 D233V probably damaging Het
Olfr1083-ps T A 2: 86,606,719 N284I unknown Het
Olfr122 A T 17: 37,771,680 Q9L possibly damaging Het
Olfr1295 C A 2: 111,564,821 V208L probably benign Het
Olfr30 T A 11: 58,455,889 N20I probably benign Het
Olfr770 T A 10: 129,133,640 I43F probably damaging Het
Parvb A T 15: 84,290,450 Q148L probably damaging Het
Pcdhb11 C T 18: 37,423,444 T609M probably damaging Het
Pcdhga3 A T 18: 37,676,125 T544S probably benign Het
Pkd1 C G 17: 24,569,741 I824M probably benign Het
Pkd1l2 A T 8: 117,068,110 L370Q probably damaging Het
Plcb1 G T 2: 135,251,764 E166* probably null Het
Pnpt1 A G 11: 29,135,522 I138V probably benign Het
Pou4f3 T C 18: 42,395,931 L313P probably damaging Het
Prep A G 10: 45,120,814 Y396C probably damaging Het
Prkd3 A T 17: 78,962,545 C562* probably null Het
Prss12 T A 3: 123,482,776 C351* probably null Het
Rnf41 C A 10: 128,438,414 H312N probably damaging Het
Ror1 C T 4: 100,441,059 T543I probably benign Het
Rreb1 G A 13: 37,931,748 V1028I probably benign Het
Setd2 T A 9: 110,594,632 S474T Het
Slc1a2 T A 2: 102,739,930 C184* probably null Het
Slc2a4 G A 11: 69,946,376 T78I probably benign Het
Slc4a4 T A 5: 89,129,650 I317N possibly damaging Het
Smad9 G A 3: 54,786,326 probably null Het
Sst T C 16: 23,889,826 E85G probably damaging Het
Svep1 T G 4: 58,066,468 E3205D possibly damaging Het
Tmc7 G T 7: 118,541,966 S647R probably benign Het
Tmem173 T C 18: 35,738,713 Y162C probably damaging Het
Trnt1 T C 6: 106,774,532 S157P possibly damaging Het
Ttc6 A T 12: 57,673,136 H831L probably benign Het
Vmn1r121 A G 7: 21,098,170 F115S probably damaging Het
Vwa7 A G 17: 35,019,044 D207G possibly damaging Het
Vwde C A 6: 13,204,981 K300N probably null Het
Zfp418 A G 7: 7,181,397 T120A possibly damaging Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57240628 missense probably damaging 1.00
IGL00736:Megf10 APN 18 57292710 missense probably benign 0.35
IGL01631:Megf10 APN 18 57259797 missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57292632 missense probably damaging 1.00
IGL02747:Megf10 APN 18 57290493 missense probably benign 0.43
IGL03298:Megf10 APN 18 57283838 nonsense probably null
deep UTSW 18 57262131 missense probably damaging 1.00
megalodon UTSW 18 57287976 nonsense probably null
sharkie UTSW 18 57191185 nonsense probably null
IGL03046:Megf10 UTSW 18 57287983 missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57277688 missense probably damaging 1.00
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57259802 missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57252982 missense probably benign 0.34
R0602:Megf10 UTSW 18 57262100 missense probably damaging 0.98
R0630:Megf10 UTSW 18 57287995 missense probably benign 0.14
R0652:Megf10 UTSW 18 57277724 missense probably benign 0.00
R0658:Megf10 UTSW 18 57252896 missense probably benign 0.00
R0761:Megf10 UTSW 18 57287976 nonsense probably null
R1013:Megf10 UTSW 18 57261219 missense probably benign 0.00
R1130:Megf10 UTSW 18 57262006 missense probably benign 0.06
R1451:Megf10 UTSW 18 57252859 missense probably damaging 0.97
R1699:Megf10 UTSW 18 57277730 splice site probably null
R1729:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1784:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1870:Megf10 UTSW 18 57191185 nonsense probably null
R1961:Megf10 UTSW 18 57212354 missense probably damaging 0.97
R2094:Megf10 UTSW 18 57281713 nonsense probably null
R2213:Megf10 UTSW 18 57288009 nonsense probably null
R2853:Megf10 UTSW 18 57293931 missense probably damaging 1.00
R3772:Megf10 UTSW 18 57283862 missense probably benign 0.39
R3774:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3775:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3776:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3858:Megf10 UTSW 18 57275835 splice site probably benign
R3911:Megf10 UTSW 18 57289393 missense probably damaging 0.99
R3966:Megf10 UTSW 18 57180574 missense probably damaging 1.00
R4043:Megf10 UTSW 18 57259798 missense probably damaging 0.98
R4131:Megf10 UTSW 18 57180535 missense probably damaging 1.00
R4598:Megf10 UTSW 18 57189603 critical splice donor site probably null
R4598:Megf10 UTSW 18 57287812 missense probably damaging 1.00
R4726:Megf10 UTSW 18 57287792 missense probably benign 0.32
R4765:Megf10 UTSW 18 57287794 missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57293858 missense probably benign 0.00
R4928:Megf10 UTSW 18 57240673 missense probably benign
R5412:Megf10 UTSW 18 57191147 missense probably damaging 0.99
R5901:Megf10 UTSW 18 57277108 missense probably benign 0.11
R6015:Megf10 UTSW 18 57253028 missense probably benign 0.01
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6041:Megf10 UTSW 18 57180549 missense probably benign
R6369:Megf10 UTSW 18 57261187 missense probably benign 0.06
R6479:Megf10 UTSW 18 57246570 missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57291807 missense probably benign 0.01
R7228:Megf10 UTSW 18 57189589 missense probably damaging 1.00
R7296:Megf10 UTSW 18 57275753 missense probably damaging 1.00
R7437:Megf10 UTSW 18 57262131 missense probably damaging 1.00
R7461:Megf10 UTSW 18 57252853 missense probably damaging 0.98
R7488:Megf10 UTSW 18 57191115 missense probably damaging 0.99
R7542:Megf10 UTSW 18 57189570 missense probably benign 0.07
R7636:Megf10 UTSW 18 57276989 missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57293999 unclassified probably benign
R7650:Megf10 UTSW 18 57293999 unclassified probably benign
R7713:Megf10 UTSW 18 57293999 unclassified probably benign
R7714:Megf10 UTSW 18 57293999 unclassified probably benign
R7716:Megf10 UTSW 18 57293999 unclassified probably benign
R7796:Megf10 UTSW 18 57277659 missense possibly damaging 0.85
R7915:Megf10 UTSW 18 57240735 missense probably benign 0.05
R8221:Megf10 UTSW 18 57283821 missense probably benign 0.00
R8527:Megf10 UTSW 18 57292718 missense probably benign 0.00
R8559:Megf10 UTSW 18 57240627 missense probably damaging 1.00
R9117:Megf10 UTSW 18 57259701 missense probably damaging 1.00
R9337:Megf10 UTSW 18 57261180 nonsense probably null
R9481:Megf10 UTSW 18 57262018 missense probably benign 0.38
R9644:Megf10 UTSW 18 57242701 missense probably benign
RF003:Megf10 UTSW 18 57294027 unclassified probably benign
Z1176:Megf10 UTSW 18 57277694 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCATCAGGGATGAACATGTCTG -3'
(R):5'- CCAAACAGATTCGCCAGTGG -3'

Sequencing Primer
(F):5'- ATACAGCATGCTTGGGTCCAG -3'
(R):5'- AGTGGCATTCTCTCCTTGC -3'
Posted On 2019-10-17