Incidental Mutation 'R7646:Megf10'
ID 590573
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Name multiple EGF-like-domains 10
Synonyms 3000002B06Rik, LOC240312
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock # R7646 (G1)
Quality Score 217.468
Status Validated
Chromosome 18
Chromosomal Location 57133090-57297467 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA to GGCAGCAACAGCACCAGCAGCA at 57293999 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
AlphaFold Q6DIB5
Predicted Effect probably benign
Transcript: ENSMUST00000075770
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139892
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,514,714 H936R probably benign Het
Afg3l1 C A 8: 123,493,027 D431E possibly damaging Het
Agrn T C 4: 156,195,354 N120S probably damaging Het
Apob A G 12: 8,009,189 D2557G probably damaging Het
Atl2 A G 17: 79,854,607 Y359H probably damaging Het
Banp T C 8: 122,024,036 S489P possibly damaging Het
Cage1 A G 13: 38,022,847 C341R probably damaging Het
Cdh23 T C 10: 60,305,152 N3139S possibly damaging Het
Chd2 G T 7: 73,435,773 S1704R possibly damaging Het
Col4a2 T A 8: 11,445,086 F1515I probably benign Het
Crocc T A 4: 141,021,655 Q1613L probably null Het
Cttnbp2 A T 6: 18,375,940 S1533R probably damaging Het
Dlgap5 C T 14: 47,399,519 probably null Het
Dnah8 G A 17: 30,649,677 D362N probably benign Het
Elf5 G T 2: 103,439,243 K56N probably benign Het
Emsy G A 7: 98,619,353 P508S probably damaging Het
Fam135a T C 1: 24,028,623 H1055R probably benign Het
Fh1 C T 1: 175,614,913 V124I probably benign Het
Gbf1 T A 19: 46,283,672 D1610E probably damaging Het
Glp1r A G 17: 30,936,283 K415E probably benign Het
Glyr1 T C 16: 5,018,497 D496G probably damaging Het
Herc2 A G 7: 56,134,613 I1342V probably benign Het
Hoxa7 A G 6: 52,215,719 *230Q probably null Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ildr1 T A 16: 36,721,919 M271K possibly damaging Het
Klk1b22 T G 7: 44,116,118 probably null Het
Lig3 T A 11: 82,783,478 N43K probably benign Het
Mcmdc2 A G 1: 9,912,135 T83A possibly damaging Het
Mki67 A T 7: 135,696,769 S2179T possibly damaging Het
Mrpl38 G A 11: 116,132,767 S282L probably damaging Het
Ndst2 A G 14: 20,724,459 probably null Het
Nlrp4a C G 7: 26,449,562 A198G probably damaging Het
Nup98 A C 7: 102,154,035 S653A probably benign Het
Olfr1084 C A 2: 86,639,169 D180Y probably damaging Het
Olfr1120 A G 2: 87,357,758 I105V probably benign Het
Olfr116 G T 17: 37,624,404 T77K probably damaging Het
Olfr60 A G 7: 140,345,951 F13L probably damaging Het
Olfr632 G A 7: 103,938,297 A306T probably damaging Het
Pclo A T 5: 14,520,895 D98V probably damaging Het
Peg3 A T 7: 6,709,222 D1000E probably benign Het
Polr3h A G 15: 81,917,370 Y131H probably damaging Het
Rapgef6 A G 11: 54,625,954 I346V probably benign Het
Rufy1 T A 11: 50,410,609 K332M probably damaging Het
Scn1a T C 2: 66,287,758 M404V possibly damaging Het
Sept8 T A 11: 53,537,917 probably null Het
Sesn3 A G 9: 14,308,615 D100G probably damaging Het
Setx A G 2: 29,177,549 I2388V possibly damaging Het
Skint5 T A 4: 113,763,542 probably null Het
Slc25a23 C T 17: 57,059,759 probably benign Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slco3a1 G A 7: 74,504,596 A76V probably damaging Het
Stradb A T 1: 58,994,408 D410V probably benign Het
Syne1 T C 10: 5,172,949 D329G probably damaging Het
Syt4 A C 18: 31,441,605 S320A possibly damaging Het
Tnfsf4 A G 1: 161,417,162 T141A possibly damaging Het
Trim34b G A 7: 104,335,352 A279T probably damaging Het
Trpm6 A T 19: 18,867,961 D1675V probably benign Het
Vmn2r24 T A 6: 123,816,210 M832K probably benign Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xkr6 G T 14: 63,606,974 D149Y probably damaging Het
Zfp108 A G 7: 24,261,415 Y477C probably damaging Het
Zfp37 T G 4: 62,191,295 I552L probably damaging Het
Zfp426 A T 9: 20,470,024 S556T probably damaging Het
Zfp954 G A 7: 7,115,721 L275F possibly damaging Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57240628 missense probably damaging 1.00
IGL00736:Megf10 APN 18 57292710 missense probably benign 0.35
IGL01631:Megf10 APN 18 57259797 missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57292632 missense probably damaging 1.00
IGL02747:Megf10 APN 18 57290493 missense probably benign 0.43
IGL03298:Megf10 APN 18 57283838 nonsense probably null
deep UTSW 18 57262131 missense probably damaging 1.00
megalodon UTSW 18 57287976 nonsense probably null
sharkie UTSW 18 57191185 nonsense probably null
IGL03046:Megf10 UTSW 18 57287983 missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57277688 missense probably damaging 1.00
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57259802 missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57252982 missense probably benign 0.34
R0602:Megf10 UTSW 18 57262100 missense probably damaging 0.98
R0630:Megf10 UTSW 18 57287995 missense probably benign 0.14
R0652:Megf10 UTSW 18 57277724 missense probably benign 0.00
R0658:Megf10 UTSW 18 57252896 missense probably benign 0.00
R0761:Megf10 UTSW 18 57287976 nonsense probably null
R1013:Megf10 UTSW 18 57261219 missense probably benign 0.00
R1130:Megf10 UTSW 18 57262006 missense probably benign 0.06
R1451:Megf10 UTSW 18 57252859 missense probably damaging 0.97
R1699:Megf10 UTSW 18 57277730 splice site probably null
R1729:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1784:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1870:Megf10 UTSW 18 57191185 nonsense probably null
R1961:Megf10 UTSW 18 57212354 missense probably damaging 0.97
R2094:Megf10 UTSW 18 57281713 nonsense probably null
R2213:Megf10 UTSW 18 57288009 nonsense probably null
R2853:Megf10 UTSW 18 57293931 missense probably damaging 1.00
R3772:Megf10 UTSW 18 57283862 missense probably benign 0.39
R3774:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3775:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3776:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3858:Megf10 UTSW 18 57275835 splice site probably benign
R3911:Megf10 UTSW 18 57289393 missense probably damaging 0.99
R3966:Megf10 UTSW 18 57180574 missense probably damaging 1.00
R4043:Megf10 UTSW 18 57259798 missense probably damaging 0.98
R4131:Megf10 UTSW 18 57180535 missense probably damaging 1.00
R4598:Megf10 UTSW 18 57189603 critical splice donor site probably null
R4598:Megf10 UTSW 18 57287812 missense probably damaging 1.00
R4726:Megf10 UTSW 18 57287792 missense probably benign 0.32
R4765:Megf10 UTSW 18 57287794 missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57293858 missense probably benign 0.00
R4928:Megf10 UTSW 18 57240673 missense probably benign
R5412:Megf10 UTSW 18 57191147 missense probably damaging 0.99
R5901:Megf10 UTSW 18 57277108 missense probably benign 0.11
R6015:Megf10 UTSW 18 57253028 missense probably benign 0.01
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6041:Megf10 UTSW 18 57180549 missense probably benign
R6369:Megf10 UTSW 18 57261187 missense probably benign 0.06
R6479:Megf10 UTSW 18 57246570 missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57291807 missense probably benign 0.01
R7228:Megf10 UTSW 18 57189589 missense probably damaging 1.00
R7296:Megf10 UTSW 18 57275753 missense probably damaging 1.00
R7437:Megf10 UTSW 18 57262131 missense probably damaging 1.00
R7461:Megf10 UTSW 18 57252853 missense probably damaging 0.98
R7488:Megf10 UTSW 18 57191115 missense probably damaging 0.99
R7492:Megf10 UTSW 18 57291794 missense probably benign 0.00
R7542:Megf10 UTSW 18 57189570 missense probably benign 0.07
R7636:Megf10 UTSW 18 57276989 missense possibly damaging 0.85
R7650:Megf10 UTSW 18 57293999 unclassified probably benign
R7713:Megf10 UTSW 18 57293999 unclassified probably benign
R7714:Megf10 UTSW 18 57293999 unclassified probably benign
R7716:Megf10 UTSW 18 57293999 unclassified probably benign
R7796:Megf10 UTSW 18 57277659 missense possibly damaging 0.85
R7915:Megf10 UTSW 18 57240735 missense probably benign 0.05
R8221:Megf10 UTSW 18 57283821 missense probably benign 0.00
R8527:Megf10 UTSW 18 57292718 missense probably benign 0.00
R8559:Megf10 UTSW 18 57240627 missense probably damaging 1.00
R9117:Megf10 UTSW 18 57259701 missense probably damaging 1.00
R9337:Megf10 UTSW 18 57261180 nonsense probably null
R9481:Megf10 UTSW 18 57262018 missense probably benign 0.38
R9644:Megf10 UTSW 18 57242701 missense probably benign
RF003:Megf10 UTSW 18 57294027 unclassified probably benign
Z1176:Megf10 UTSW 18 57277694 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATATGTACAAGAAGTAGCAGCATC -3'
(R):5'- TGGTACACGTCCAACAACTGC -3'

Sequencing Primer
(F):5'- AAAACTCTCTTGCTGATATTTTGTTG -3'
(R):5'- CGTCCAACAACTGCTTATTAGAG -3'
Posted On 2019-10-24