Incidental Mutation 'R7643:Hacd1'
ID590328
Institutional Source Beutler Lab
Gene Symbol Hacd1
Ensembl Gene ENSMUSG00000063275
Gene Name3-hydroxyacyl-CoA dehydratase 1
SynonymsPtpla
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R7643 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location13850282-14056135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14044791 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 119 (I119V)
Ref Sequence ENSEMBL: ENSMUSP00000088998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074854] [ENSMUST00000091429] [ENSMUST00000114753] [ENSMUST00000131730]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074854
AA Change: I119V

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074397
Gene: ENSMUSG00000063275
AA Change: I119V

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:PTPLA 79 242 1.7e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091429
AA Change: I119V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088998
Gene: ENSMUSG00000063275
AA Change: I119V

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:PTPLA 79 144 5.3e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114753
AA Change: I119V

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110401
Gene: ENSMUSG00000063275
AA Change: I119V

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:PTPLA 79 240 3e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131730
AA Change: I119V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141406
Gene: ENSMUSG00000063275
AA Change: I119V

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:PTPLA 79 144 5.3e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a characteristic catalytic motif of the protein tyrosine phosphatases (PTPs) family. The PTP motif of this protein has the highly conserved arginine residue replaced by a proline residue; thus it may represent a distinct class of PTPs. Members of the PTP family are known to be signaling molecules that regulate a variety of cellular processes. This gene was preferentially expressed in both adult and fetal heart. A much lower expression level was detected in skeletal and smooth muscle tissues, and no expression was observed in other tissues. The tissue specific expression in the developing and adult heart suggests a role in regulating cardiac development and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout leads to decreased body size and weight and reduced skeletal muscle weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in Hacd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Hacd1 APN 2 14035856 missense probably benign 0.04
IGL01623:Hacd1 APN 2 14035856 missense probably benign 0.04
IGL01884:Hacd1 APN 2 14035782 missense probably damaging 1.00
IGL02214:Hacd1 APN 2 14026947 missense probably damaging 1.00
IGL02529:Hacd1 APN 2 14045202 missense probably damaging 1.00
R2340:Hacd1 UTSW 2 14035887 missense probably damaging 1.00
R3429:Hacd1 UTSW 2 14044775 splice site probably benign
R4946:Hacd1 UTSW 2 14045137 critical splice donor site probably null
R5103:Hacd1 UTSW 2 14040913 missense probably damaging 1.00
R6468:Hacd1 UTSW 2 14035944 missense probably damaging 0.98
R6626:Hacd1 UTSW 2 14026944 missense probably benign 0.10
R6957:Hacd1 UTSW 2 14044853 missense probably damaging 1.00
R7862:Hacd1 UTSW 2 14045202 missense probably damaging 1.00
R8146:Hacd1 UTSW 2 14044794 missense probably damaging 1.00
Z1176:Hacd1 UTSW 2 14035795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTTCACATCCAGAAAACACAG -3'
(R):5'- GGTTTCTCAATTTCCCTCCAGGTAG -3'

Sequencing Primer
(F):5'- CACAGGGGGAGATGCTATTAAC -3'
(R):5'- CCAGGTAGTCCATTGTCTGATCG -3'
Posted On2019-10-24