Mutagenetix > Incidental Mutations

Incidental Mutation 'R7643:Ap3b2'

590349

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.133) question?

Stock #

R7643 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81477072 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 310 (K310R)

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]

AlphaFold

Q9JME5

Predicted Effect

probably benign
Transcript: ENSMUST00000082090
AA Change: K310R

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: K310R

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000152355
AA Change: K310R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	A	G	16: 38,827,863	Y295H	probably benign	Het
4931406C07Rik	A	G	9: 15,297,860	F46S	probably damaging	Het
Acaca	T	C	11: 84,338,356	Y1670H	probably damaging	Het
Acrbp	G	A	6: 125,053,832	R272Q	possibly damaging	Het
Adcy6	T	A	15: 98,593,568	Q1050L	probably benign	Het
Amn1	C	T	6: 149,185,031	M44I	probably benign	Het
Ankrd13b	A	G	11: 77,473,085	V395A	probably benign	Het
Bnc2	T	C	4: 84,506,574	D123G	probably benign	Het
Bst1	G	A	5: 43,840,449	M263I	probably benign	Het
Ccdc7a	C	T	8: 128,889,811	G937E	probably damaging	Het
Cep290	A	G	10: 100,537,553	M1232V	probably benign	Het
Cfhr1	A	G	1: 139,553,585	Y186H	possibly damaging	Het
Dnah7c	A	T	1: 46,602,813	H1203L	probably benign	Het
Emc7	A	G	2: 112,455,279	E71G	probably benign	Het
Exoc3l4	G	A	12: 111,421,935		probably benign	Het
Fam83c	A	G	2: 155,831,004	F278L	possibly damaging	Het
Gabpb2	C	A	3: 95,200,225	V180L	probably benign	Het
Gbp2b	G	T	3: 142,603,609	Q160H	probably benign	Het
Gm19965	C	G	1: 116,822,229	Q547E	unknown	Het
Gm40460	ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,713		probably benign	Het
Gon4l	T	A	3: 88,902,807	D1774E	probably damaging	Het
Gpr15	A	C	16: 58,717,816	Y303*	probably null	Het
Greb1	T	C	12: 16,711,996	D461G	probably damaging	Het
Gria4	T	C	9: 4,793,950	N36S	probably benign	Het
Hacd1	T	C	2: 14,044,791	I119V	probably damaging	Het
Ing5	T	A	1: 93,812,433	D101E	probably damaging	Het
Irak4	T	A	15: 94,558,828	N297K	probably benign	Het
Itga7	A	G	10: 128,953,501	D971G	probably benign	Het
Klf5	A	G	14: 99,313,178	E397G	possibly damaging	Het
Krtap29-1	C	T	11: 99,978,198	G286S	probably damaging	Het
Lrp2bp	A	T	8: 46,020,527		probably null	Het
March4	T	G	1: 72,447,220	Q266H	probably damaging	Het
Med23	A	G	10: 24,905,965	T1056A	probably benign	Het
Megf11	T	C	9: 64,706,632	L1079P	probably damaging	Het
Mycbp2	G	T	14: 103,346,265	L85I	probably benign	Het
Nlgn2	G	T	11: 69,827,885	Q290K	probably damaging	Het
Nox4	A	T	7: 87,323,754	E323V	probably damaging	Het
Nup93	T	C	8: 94,286,619		probably null	Het
Olfr298	C	T	7: 86,489,568		probably null	Het
Olfr558	C	T	7: 102,709,538	T93I	probably benign	Het
Olfr977-ps1	T	A	9: 39,974,821	M1L	unknown	Het
Otop3	T	C	11: 115,339,648	L117P	probably damaging	Het
Pde6c	C	A	19: 38,141,421	Q260K	probably damaging	Het
Plb1	C	T	5: 32,247,557	Q20*	probably null	Het
Qser1	A	T	2: 104,786,977	Y1163*	probably null	Het
Rbm12	A	T	2: 156,098,217	I45N	unknown	Het
Rictor	T	A	15: 6,769,269	Y332*	probably null	Het
Rpp14	C	A	14: 8,090,325	S83*	probably null	Het
Sel1l3	C	T	5: 53,123,162		probably null	Het
Setd2	T	C	9: 110,567,840		probably null	Het
Spink5	A	G	18: 44,010,252	T759A	probably benign	Het
Spon2	T	A	5: 33,217,456	E2V	probably benign	Het
Tdrd1	T	C	19: 56,837,708	S144P	probably damaging	Het
Tex15	A	C	8: 33,575,120	Y1526S	probably damaging	Het
Tnfrsf21	T	C	17: 43,037,916	S140P	probably benign	Het
Trav6-2	T	A	14: 52,667,442	M11K	probably benign	Het
Trp53bp1	G	T	2: 121,247,814		probably null	Het
Ttn	T	C	2: 76,734,827	N28352S	possibly damaging	Het
Uckl1	T	C	2: 181,573,106	I292V	probably benign	Het
Unc13b	T	A	4: 43,216,333	S211T	probably benign	Het
Zcchc4	T	C	5: 52,808,293	I313T	possibly damaging	Het
Zfp106	C	T	2: 120,512,734	R1811K	probably benign	Het
Zfp599	G	T	9: 22,249,892	Q326K	probably benign	Het
Zscan4e	A	T	7: 11,309,525	M108K	probably damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8325:Ap3b2	UTSW	7	81484489	splice site	probably null
R8355:Ap3b2	UTSW	7	81473103	missense	probably damaging	1.00
R8697:Ap3b2	UTSW	7	81473035	missense	possibly damaging	0.91
R8716:Ap3b2	UTSW	7	81477153	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81477183	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81467444	missense	probably benign	0.02
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGAGGTTAGCCAAACAGCTG -3'
(R):5'- GAAGATGTCCATACACACAGCTG -3'

Sequencing Primer
(F):5'- TTAGCCAAACAGCTGGGAGG -3'
(R):5'- ACACACAGCTGTATCTCTTTCAGGAG -3'

Posted On

2019-10-24