Incidental Mutation 'R7655:Orc3'
ID591118
Institutional Source Beutler Lab
Gene Symbol Orc3
Ensembl Gene ENSMUSG00000040044
Gene Nameorigin recognition complex, subunit 3
SynonymsOrc3l
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7655 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location34570796-34614944 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 34587032 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 352 (C352*)
Ref Sequence ENSEMBL: ENSMUSP00000048319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048706] [ENSMUST00000108142]
Predicted Effect probably null
Transcript: ENSMUST00000048706
AA Change: C352*
SMART Domains Protein: ENSMUSP00000048319
Gene: ENSMUSG00000040044
AA Change: C352*

DomainStartEndE-ValueType
Pfam:ORC3_N 25 350 3e-130 PFAM
low complexity region 653 664 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108142
AA Change: C352*
SMART Domains Protein: ENSMUSP00000103777
Gene: ENSMUSG00000040044
AA Change: C352*

DomainStartEndE-ValueType
Pfam:ORC3_N 24 350 7.7e-136 PFAM
low complexity region 652 663 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Studies of a similar gene in Drosophila suggested a possible role of this protein in neuronal proliferation and olfactory memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in the neural cells exhibit reduced neuronal precursor proliferation and reduced radial glial cell. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Ghdc C T 11: 100,769,667 A127T probably benign Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Orc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Orc3 APN 4 34595096 missense probably damaging 1.00
IGL03293:Orc3 APN 4 34595210 missense probably damaging 0.96
IGL02991:Orc3 UTSW 4 34593083 missense probably damaging 1.00
R0157:Orc3 UTSW 4 34607130 critical splice donor site probably null
R0708:Orc3 UTSW 4 34597368 missense probably damaging 1.00
R1331:Orc3 UTSW 4 34599748 missense probably benign 0.01
R1481:Orc3 UTSW 4 34607228 missense possibly damaging 0.50
R1755:Orc3 UTSW 4 34575114 missense possibly damaging 0.67
R1886:Orc3 UTSW 4 34584829 missense probably damaging 1.00
R2008:Orc3 UTSW 4 34611049 unclassified probably null
R2054:Orc3 UTSW 4 34584846 missense probably damaging 0.97
R2307:Orc3 UTSW 4 34586503 missense probably damaging 1.00
R3001:Orc3 UTSW 4 34571790 missense probably benign 0.10
R3002:Orc3 UTSW 4 34571790 missense probably benign 0.10
R3153:Orc3 UTSW 4 34575124 missense probably damaging 0.99
R4044:Orc3 UTSW 4 34587055 nonsense probably null
R4814:Orc3 UTSW 4 34572450 splice site probably benign
R4825:Orc3 UTSW 4 34571774 missense possibly damaging 0.95
R4939:Orc3 UTSW 4 34593126 nonsense probably null
R6314:Orc3 UTSW 4 34579797 missense possibly damaging 0.85
R6867:Orc3 UTSW 4 34605539 missense probably damaging 1.00
R7227:Orc3 UTSW 4 34572542 missense probably benign 0.00
R7417:Orc3 UTSW 4 34595136 missense probably damaging 1.00
R7656:Orc3 UTSW 4 34587032 nonsense probably null
R7707:Orc3 UTSW 4 34598691 nonsense probably null
R7856:Orc3 UTSW 4 34585647 missense probably benign
R7939:Orc3 UTSW 4 34585647 missense probably benign
R8058:Orc3 UTSW 4 34595223 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTTCTATACTGCAAAATGAAAGGC -3'
(R):5'- TCCATAGAACTGCAGCCTTGG -3'

Sequencing Primer
(F):5'- ACAACTGAAGCCAGAAGT -3'
(R):5'- CCACATGTGCAGTGCCTTAAAGG -3'
Posted On2019-11-12