Incidental Mutation 'R7693:Dnaja2'
ID593500
Institutional Source Beutler Lab
Gene Symbol Dnaja2
Ensembl Gene ENSMUSG00000031701
Gene NameDnaJ heat shock protein family (Hsp40) member A2
Synonyms2010206B19Rik, mDj3, HIRIP4, 1500017M13Rik, PRO3015, DNJ3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.708) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location85537633-85555344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85540310 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 306 (P306Q)
Ref Sequence ENSEMBL: ENSMUSP00000034138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034138]
Predicted Effect probably damaging
Transcript: ENSMUST00000034138
AA Change: P306Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034138
Gene: ENSMUSG00000031701
AA Change: P306Q

DomainStartEndE-ValueType
DnaJ 7 62 8.53e-31 SMART
low complexity region 70 83 N/A INTRINSIC
low complexity region 101 113 N/A INTRINSIC
Pfam:DnaJ_C 116 338 8.5e-36 PFAM
Pfam:DnaJ_CXXCXGXG 143 209 3.4e-18 PFAM
low complexity region 393 403 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain. The product of this gene works as a cochaperone of Hsp70s in protein folding and mitochondrial protein import in vitro. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Dnaja2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Dnaja2 APN 8 85555237 missense probably damaging 0.98
IGL01479:Dnaja2 APN 8 85553951 missense probably damaging 1.00
IGL01722:Dnaja2 APN 8 85553279 missense probably benign 0.35
IGL01946:Dnaja2 APN 8 85546700 missense probably damaging 1.00
IGL03310:Dnaja2 APN 8 85548905 missense probably benign 0.00
R0689:Dnaja2 UTSW 8 85546718 splice site probably benign
R1350:Dnaja2 UTSW 8 85540088 missense probably damaging 1.00
R2332:Dnaja2 UTSW 8 85540136 missense probably damaging 1.00
R3105:Dnaja2 UTSW 8 85555228 missense probably damaging 1.00
R3693:Dnaja2 UTSW 8 85546620 missense probably damaging 0.99
R3787:Dnaja2 UTSW 8 85540386 missense probably damaging 1.00
R4803:Dnaja2 UTSW 8 85553400 missense probably damaging 1.00
R5109:Dnaja2 UTSW 8 85553258 missense possibly damaging 0.51
R5428:Dnaja2 UTSW 8 85540175 missense probably benign
R5576:Dnaja2 UTSW 8 85539404 missense possibly damaging 0.95
R7055:Dnaja2 UTSW 8 85548674 missense probably benign 0.00
R7385:Dnaja2 UTSW 8 85539353 missense probably benign
R7662:Dnaja2 UTSW 8 85539276 missense probably benign 0.17
R8049:Dnaja2 UTSW 8 85539247 missense possibly damaging 0.63
Z1177:Dnaja2 UTSW 8 85540071 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAAGGGATTACGATACTGTGGC -3'
(R):5'- ACTTAAGGAATGCTCAGCAGG -3'

Sequencing Primer
(F):5'- GATTACGATACTGTGGCATTCC -3'
(R):5'- ATGCTCAGCAGGGTAATGTG -3'
Posted On2019-11-12