Incidental Mutation 'R7693:Azi2'
ID593505
Institutional Source Beutler Lab
Gene Symbol Azi2
Ensembl Gene ENSMUSG00000039285
Gene Name5-azacytidine induced gene 2
SynonymsAZ2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location118040499-118069794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118047593 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 59 (N59I)
Ref Sequence ENSEMBL: ENSMUSP00000044350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044454] [ENSMUST00000133580] [ENSMUST00000134433] [ENSMUST00000135251] [ENSMUST00000154583]
Predicted Effect probably damaging
Transcript: ENSMUST00000044454
AA Change: N59I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044350
Gene: ENSMUSG00000039285
AA Change: N59I

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 224 278 4.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130735
SMART Domains Protein: ENSMUSP00000114634
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 22 123 N/A INTRINSIC
Pfam:TBD 153 197 3.8e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133580
AA Change: N59I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118765
Gene: ENSMUSG00000039285
AA Change: N59I

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 226 278 1.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134433
AA Change: N59I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114980
Gene: ENSMUSG00000039285
AA Change: N59I

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 224 273 1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135251
SMART Domains Protein: ENSMUSP00000116971
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 20 50 N/A INTRINSIC
Pfam:TBD 77 131 1.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154583
AA Change: N59I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122063
Gene: ENSMUSG00000039285
AA Change: N59I

DomainStartEndE-ValueType
coiled coil region 40 83 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AZI2, or NAP1, contributes to the activation of NFKB (see MIM 164011)-dependent gene expression by activating IKK-related kinases, such as NAK (TBK1; MIM 604834) (Fujita et al., 2003 [PubMed 14560022]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired GM-CSF-derived bone marrow-derived dendritic cell differenatiation, cytokine response and ability to stimulate T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Azi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03085:Azi2 APN 9 118059146 missense probably damaging 0.97
awry UTSW 9 118047419 start codon destroyed probably null 0.99
R0166:Azi2 UTSW 9 118055841 missense possibly damaging 0.82
R0636:Azi2 UTSW 9 118062057 missense probably benign 0.03
R2024:Azi2 UTSW 9 118049322 nonsense probably null
R3498:Azi2 UTSW 9 118049407 missense probably damaging 0.99
R3713:Azi2 UTSW 9 118047440 missense possibly damaging 0.65
R3899:Azi2 UTSW 9 118047503 missense probably damaging 1.00
R4765:Azi2 UTSW 9 118061471 unclassified probably benign
R5227:Azi2 UTSW 9 118047458 missense probably damaging 1.00
R5839:Azi2 UTSW 9 118059119 missense probably damaging 1.00
R5885:Azi2 UTSW 9 118047560 missense probably damaging 1.00
R6021:Azi2 UTSW 9 118047419 start codon destroyed probably null 0.99
R6276:Azi2 UTSW 9 118049338 missense probably damaging 0.96
R6408:Azi2 UTSW 9 118061482 nonsense probably null
R6525:Azi2 UTSW 9 118047595 missense probably damaging 0.96
R6889:Azi2 UTSW 9 118049895 critical splice acceptor site probably null
R7391:Azi2 UTSW 9 118050892 splice site probably null
R7889:Azi2 UTSW 9 118061915 missense probably benign 0.20
R8042:Azi2 UTSW 9 118062097 missense probably benign 0.01
R8142:Azi2 UTSW 9 118049407 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATGGACACGCTAGTAGAAG -3'
(R):5'- CCATTACATAGCAATGCCAGAAGG -3'

Sequencing Primer
(F):5'- CACGCTAGTAGAAGATGACATCTGC -3'
(R):5'- TGAACACACGATATGACTGATGC -3'
Posted On2019-11-12