Mutagenetix > Incidental Mutations

Incidental Mutation 'R8516:Piwil2'

656173

Institutional Source

Beutler Lab

Gene Symbol

Piwil2

Ensembl Gene

ENSMUSG00000033644

Gene Name

piwi-like RNA-mediated gene silencing 2

Synonyms

Miwi like, mili

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8516 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70372477-70429383 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70420739 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 213 (V213A)

Ref Sequence

ENSEMBL: ENSMUSP00000047385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048129] [ENSMUST00000226229]

AlphaFold

Q8CDG1

PDB Structure

Structure of extended Tudor domain TD3 from mouse TDRD1 in complex with MILI peptide containing dimethylarginine 45. [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000048129
AA Change: V213A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000047385
Gene: ENSMUSG00000033644
AA Change: V213A

Domain	Start	End	E-Value	Type
low complexity region	35	46	N/A	INTRINSIC
low complexity region	90	102	N/A	INTRINSIC
low complexity region	176	190	N/A	INTRINSIC
DUF1785	335	386	7.44e-2	SMART
PAZ	386	524	1.92e-62	SMART
Piwi	666	957	2.45e-119	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226229
AA Change: V213A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL2 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testis weight, azoospermia, and male infertility associated with a complete arrest of spermatogenesis and increased apoptotic cell death during the early prophase of the first meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,373	S22T	probably benign	Het
Actr8	G	T	14: 29,990,899	A500S	probably benign	Het
Adamtsl1	A	G	4: 86,342,543	Y1005C	probably damaging	Het
Ank3	T	A	10: 69,927,729	Y884*	probably null	Het
Arhgap28	T	C	17: 67,873,073	R306G	probably benign	Het
Atp8a2	A	C	14: 59,691,472	I1044M	probably benign	Het
Bahd1	A	G	2: 118,916,971	Y357C	probably benign	Het
Btd	A	T	14: 31,666,867	T182S	probably damaging	Het
Casc3	C	T	11: 98,822,781	R280C	probably damaging	Het
Cisd2	T	C	3: 135,411,013	T106A	probably damaging	Het
Cldn15	G	T	5: 136,974,696	C184F	probably damaging	Het
Clk4	G	A	11: 51,275,261	R198Q	probably damaging	Het
Coprs	G	T	8: 13,885,065	F163L	probably damaging	Het
Csmd3	G	A	15: 47,629,365	R2216*	probably null	Het
Defb7	A	T	8: 19,497,607	I43F	possibly damaging	Het
Dpp8	C	A	9: 65,078,009	T783K	probably damaging	Het
Eif2s1	G	A	12: 78,881,162	G204D	probably damaging	Het
Elavl4	T	C	4: 110,251,379	N56S	probably damaging	Het
Emilin1	G	A	5: 30,917,171	R252H	probably damaging	Het
Exd1	A	T	2: 119,520,073	L569Q	probably damaging	Het
Gm498	T	A	7: 143,897,274	I342N	probably damaging	Het
Gpn2	C	T	4: 133,584,831	R125C	probably damaging	Het
Gria2	T	C	3: 80,706,987	E582G	probably benign	Het
Hadha	A	T	5: 30,126,584	V458E	probably damaging	Het
Hap1	T	C	11: 100,356,067	K4R	possibly damaging	Het
Hectd4	A	T	5: 121,349,010	H3356L	possibly damaging	Het
Herc2	G	A	7: 56,206,570	V3919I	probably benign	Het
Lgr6	G	T	1: 135,075,283	N76K	probably damaging	Het
Olfr692	A	G	7: 105,368,769	I148V	probably benign	Het
P4ha3	A	G	7: 100,314,662	M462V	probably damaging	Het
Pde3b	A	T	7: 114,526,849	M773L	probably benign	Het
Peak1	T	C	9: 56,260,000	S215G	probably damaging	Het
Pgm5	T	A	19: 24,815,710	M331L	probably benign	Het
Plch2	T	C	4: 154,986,307	H1205R	probably benign	Het
Pop4	A	T	7: 38,267,402	M85K	probably benign	Het
Ppp3ca	T	A	3: 136,877,768	I212N	probably damaging	Het
Prom1	T	C	5: 44,007,099	K714R	probably benign	Het
Psip1	C	T	4: 83,466,715	G207S	probably benign	Het
Rgs22	A	G	15: 36,010,335	*1259Q	probably null	Het
Scn1a	C	T	2: 66,326,134	G477D	possibly damaging	Het
Sf3b1	T	C	1: 55,012,103	E222G	probably null	Het
Snrpa1	G	A	7: 66,070,633	G195R	probably benign	Het
Spem2	T	C	11: 69,816,895	R415G	possibly damaging	Het
Tmem167	T	A	13: 90,098,396	V13E	probably damaging	Het
Trim2	C	T	3: 84,208,320	A102T	probably damaging	Het
Trim30b	A	G	7: 104,357,404	S82P	probably benign	Het
Uba6	A	C	5: 86,127,748	S760R	possibly damaging	Het
Upf2	T	C	2: 6,018,971	F711L	unknown	Het
Utrn	T	A	10: 12,486,510	D2693V	probably damaging	Het
Vmn1r30	T	G	6: 58,435,124	Y241S	probably damaging	Het
Vmn2r110	A	G	17: 20,574,613	L598P	probably damaging	Het
Wfdc18	T	A	11: 83,709,158	F14Y	probably benign	Het
Wnt10b	A	T	15: 98,772,880	C256S	probably damaging	Het
Xrn1	T	A	9: 96,048,391	Y1554*	probably null	Het
Zc3h12a	T	A	4: 125,119,839	S411C	probably damaging	Het
Zfp112	G	A	7: 24,123,964	G63E	probably benign	Het
Zfp786	A	T	6: 47,820,543	L487Q	probably damaging	Het
Zfp953	T	A	13: 67,345,355	Y75F	possibly damaging	Het

Other mutations in Piwil2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01474:Piwil2	APN	14	70398218	missense	probably benign	0.35
IGL02215:Piwil2	APN	14	70391373	missense	possibly damaging	0.50
IGL02427:Piwil2	APN	14	70398134	splice site	probably benign
IGL02554:Piwil2	APN	14	70391486	splice site	probably benign
R0257:Piwil2	UTSW	14	70422631	missense	probably benign	0.00
R0566:Piwil2	UTSW	14	70410394	missense	probably damaging	0.99
R0800:Piwil2	UTSW	14	70409037	unclassified	probably benign
R0828:Piwil2	UTSW	14	70376017	missense	probably damaging	1.00
R0862:Piwil2	UTSW	14	70395374	missense	probably benign	0.00
R0864:Piwil2	UTSW	14	70395374	missense	probably benign	0.00
R0881:Piwil2	UTSW	14	70408927	missense	probably benign	0.34
R1734:Piwil2	UTSW	14	70426505	critical splice donor site	probably null
R1997:Piwil2	UTSW	14	70426658	missense	possibly damaging	0.90
R2011:Piwil2	UTSW	14	70426634	missense	probably damaging	1.00
R2043:Piwil2	UTSW	14	70391470	missense	probably benign	0.00
R2347:Piwil2	UTSW	14	70408917	missense	probably damaging	0.98
R2998:Piwil2	UTSW	14	70411238	missense	probably damaging	1.00
R4402:Piwil2	UTSW	14	70408916	missense	probably benign	0.01
R4455:Piwil2	UTSW	14	70390565	missense	probably benign	0.02
R4611:Piwil2	UTSW	14	70402197	missense	probably benign	0.07
R4763:Piwil2	UTSW	14	70376778	missense	probably damaging	1.00
R4869:Piwil2	UTSW	14	70395362	missense	probably benign	0.00
R5033:Piwil2	UTSW	14	70421593	missense	possibly damaging	0.71
R5207:Piwil2	UTSW	14	70392517	missense	probably damaging	1.00
R5395:Piwil2	UTSW	14	70395397	missense	probably benign	0.01
R5486:Piwil2	UTSW	14	70401431	missense	probably benign	0.01
R5504:Piwil2	UTSW	14	70389899	missense	probably benign	0.01
R5629:Piwil2	UTSW	14	70422967	missense	probably damaging	1.00
R5967:Piwil2	UTSW	14	70390564	missense	probably benign	0.00
R6167:Piwil2	UTSW	14	70422893	critical splice donor site	probably null
R6168:Piwil2	UTSW	14	70395351	missense	probably benign	0.04
R6517:Piwil2	UTSW	14	70374336	missense	probably benign	0.44
R7261:Piwil2	UTSW	14	70374411	missense	probably damaging	1.00
R7727:Piwil2	UTSW	14	70394057	missense	probably damaging	1.00
R7745:Piwil2	UTSW	14	70394189	missense	probably benign
R7833:Piwil2	UTSW	14	70395441	missense	probably benign	0.02
R8044:Piwil2	UTSW	14	70391438	missense	possibly damaging	0.90
R8066:Piwil2	UTSW	14	70420719	missense	probably benign	0.00
R9015:Piwil2	UTSW	14	70390535	missense	probably benign	0.00
X0023:Piwil2	UTSW	14	70398199	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTCAGGAGTAGCTCACAGTAG -3'
(R):5'- AGTTGATGGAGCTGCTTAGC -3'

Sequencing Primer
(F):5'- AGTACTGAGTTATCTAGACCATCCC -3'
(R):5'- AGCTGGTTTTTGGGATATATGATATG -3'

Posted On

2020-10-20