Incidental Mutation 'R8001:Stox2'
ID616363
Institutional Source Beutler Lab
Gene Symbol Stox2
Ensembl Gene ENSMUSG00000038143
Gene Namestorkhead box 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R8001 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location47180048-47446362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47186477 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 894 (P894L)
Ref Sequence ENSEMBL: ENSMUSP00000078190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079195] [ENSMUST00000110367] [ENSMUST00000211737] [ENSMUST00000211882]
Predicted Effect probably benign
Transcript: ENSMUST00000079195
AA Change: P894L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078190
Gene: ENSMUSG00000038143
AA Change: P894L

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Pfam:Stork_head 63 141 4.5e-35 PFAM
low complexity region 225 236 N/A INTRINSIC
low complexity region 352 377 N/A INTRINSIC
low complexity region 459 473 N/A INTRINSIC
low complexity region 654 674 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110367
SMART Domains Protein: ENSMUSP00000105996
Gene: ENSMUSG00000038143

DomainStartEndE-ValueType
Pfam:Stork_head 1 79 5.6e-35 PFAM
low complexity region 163 174 N/A INTRINSIC
low complexity region 290 315 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
low complexity region 592 612 N/A INTRINSIC
low complexity region 655 669 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211737
Predicted Effect probably benign
Transcript: ENSMUST00000211882
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Storkhead-box_winged-helix domain containing protein. This protein is differentially expressed in decidual tissue and may be involved in the susceptibility to pre-eclampsia with fetal growth restriction. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A G 1: 93,154,599 L266P probably damaging Het
Acr A G 15: 89,573,962 Y282C probably damaging Het
Alkbh4 A G 5: 136,140,269 R136G probably damaging Het
Bptf C A 11: 107,047,340 E2* probably null Het
Cse1l T A 2: 166,939,913 F659Y probably damaging Het
Ctrc A T 4: 141,840,360 L144Q probably damaging Het
Elmo1 A G 13: 20,286,732 I265V probably benign Het
Erich3 T C 3: 154,713,916 S19P probably benign Het
Hmcn1 A T 1: 150,664,878 C2893* probably null Het
Hnrnpll G A 17: 80,038,723 Q370* probably null Het
Itpkb T C 1: 180,332,494 S62P probably damaging Het
Lig3 T A 11: 82,792,076 C501S probably benign Het
Nrxn1 C T 17: 91,088,536 R64H possibly damaging Het
Ogfod2 T G 5: 124,114,883 C319G probably damaging Het
Olfr1474 A G 19: 13,471,422 I109V probably benign Het
Olfr201 T C 16: 59,269,109 N186S probably benign Het
Olfr555 A T 7: 102,659,034 D71V probably damaging Het
Olfr827 A G 10: 130,210,860 V90A probably benign Het
Pabpc6 C A 17: 9,669,373 R83L probably damaging Het
Pcdhgb2 A T 18: 37,690,634 Q226L probably benign Het
Pole A T 5: 110,312,734 I1127F probably damaging Het
Psg22 A T 7: 18,719,746 Q161L possibly damaging Het
Slc17a7 A T 7: 45,168,788 T46S probably benign Het
Smad4 A G 18: 73,641,810 S473P probably damaging Het
Snap47 T A 11: 59,438,354 T41S probably benign Het
Snx21 T C 2: 164,786,737 L100P probably benign Het
Stc1 T A 14: 69,038,395 N212K probably benign Het
Stk32a A T 18: 43,315,144 N396I possibly damaging Het
Trav16d-dv11 A G 14: 53,047,287 M1V probably null Het
Trim33 T C 3: 103,311,515 probably null Het
Tyrp1 T C 4: 80,840,670 V260A probably benign Het
Ush2a T C 1: 188,911,064 Y4208H probably damaging Het
Vmn1r25 T A 6: 57,979,080 K75* probably null Het
Vmn2r117 T A 17: 23,479,407 N64I possibly damaging Het
Wdfy4 C T 14: 32,973,535 probably null Het
Wnt8a A T 18: 34,545,516 I128F probably damaging Het
Zc3h7b C A 15: 81,779,260 Y484* probably null Het
Zfp619 A G 7: 39,535,221 K225R probably benign Het
Other mutations in Stox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02234:Stox2 APN 8 47193612 missense probably damaging 1.00
IGL02331:Stox2 APN 8 47191944 missense probably damaging 0.96
IGL02399:Stox2 APN 8 47186538 missense probably damaging 0.99
IGL03091:Stox2 APN 8 47193187 missense possibly damaging 0.66
IGL03143:Stox2 APN 8 47193804 missense possibly damaging 0.78
IGL03307:Stox2 APN 8 47194030 missense probably damaging 1.00
R0082:Stox2 UTSW 8 47203282 splice site probably benign
R0313:Stox2 UTSW 8 47192134 missense probably damaging 1.00
R0382:Stox2 UTSW 8 47203284 splice site probably benign
R0513:Stox2 UTSW 8 47193865 missense probably damaging 1.00
R0539:Stox2 UTSW 8 47194035 missense probably damaging 0.97
R0920:Stox2 UTSW 8 47193018 missense probably damaging 1.00
R1764:Stox2 UTSW 8 47194016 nonsense probably null
R1923:Stox2 UTSW 8 47193626 missense probably damaging 1.00
R2311:Stox2 UTSW 8 47191978 missense probably damaging 1.00
R3196:Stox2 UTSW 8 47192830 missense probably damaging 0.99
R3715:Stox2 UTSW 8 47413152 missense possibly damaging 0.90
R4300:Stox2 UTSW 8 47193992 nonsense probably null
R4534:Stox2 UTSW 8 47193379 missense probably damaging 1.00
R4600:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4601:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4602:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4603:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4610:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4624:Stox2 UTSW 8 47193816 missense probably damaging 1.00
R4672:Stox2 UTSW 8 47192106 missense probably damaging 1.00
R4888:Stox2 UTSW 8 47203163 missense probably damaging 1.00
R4944:Stox2 UTSW 8 47413265 missense possibly damaging 0.46
R5331:Stox2 UTSW 8 47413627 utr 5 prime probably benign
R5349:Stox2 UTSW 8 47287916 missense possibly damaging 0.70
R5367:Stox2 UTSW 8 47203225 missense probably damaging 1.00
R5471:Stox2 UTSW 8 47193513 missense probably damaging 0.96
R5561:Stox2 UTSW 8 47193006 missense probably damaging 1.00
R5630:Stox2 UTSW 8 47191890 missense probably damaging 1.00
R5719:Stox2 UTSW 8 47413137 nonsense probably null
R5733:Stox2 UTSW 8 47413137 nonsense probably null
R5996:Stox2 UTSW 8 47203147 missense possibly damaging 0.93
R6170:Stox2 UTSW 8 47192020 missense probably benign 0.02
R6458:Stox2 UTSW 8 47192044 missense possibly damaging 0.66
R6786:Stox2 UTSW 8 47186465 missense probably damaging 1.00
R6815:Stox2 UTSW 8 47193101 missense probably damaging 1.00
R6951:Stox2 UTSW 8 47203132 missense probably damaging 1.00
R7193:Stox2 UTSW 8 47186454 missense probably benign
R7330:Stox2 UTSW 8 47192236 missense possibly damaging 0.61
R7552:Stox2 UTSW 8 47203119 critical splice donor site probably null
R8266:Stox2 UTSW 8 47192025 missense probably damaging 0.99
X0027:Stox2 UTSW 8 47193840 missense possibly damaging 0.95
Z1177:Stox2 UTSW 8 47194050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAACCTGTGCTTGAGATG -3'
(R):5'- GGAAGTCCATTAGCCCCATC -3'

Sequencing Primer
(F):5'- CCAACCTGTGCTTGAGATGTTTGTC -3'
(R):5'- GAAGTCCATTAGCCCCATCACTTG -3'
Posted On2020-01-23