Mutagenetix > Incidental Mutation

Incidental Mutation 'R8001:Stox2'

616363

Institutional Source

Beutler Lab

Gene Symbol

Stox2

Ensembl Gene

ENSMUSG00000038143

Gene Name

storkhead box 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.196) question?

Stock #

R8001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

47180048-47446362 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 47186477 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 894 (P894L)

Ref Sequence

ENSEMBL: ENSMUSP00000078190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079195] [ENSMUST00000110367] [ENSMUST00000211737] [ENSMUST00000211882]

AlphaFold

Q499E5

Predicted Effect

probably benign
Transcript: ENSMUST00000079195
AA Change: P894L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000078190
Gene: ENSMUSG00000038143
AA Change: P894L

Domain	Start	End	E-Value	Type
low complexity region	15	30	N/A	INTRINSIC
Pfam:Stork_head	63	141	4.5e-35	PFAM
low complexity region	225	236	N/A	INTRINSIC
low complexity region	352	377	N/A	INTRINSIC
low complexity region	459	473	N/A	INTRINSIC
low complexity region	654	674	N/A	INTRINSIC
low complexity region	717	731	N/A	INTRINSIC
low complexity region	783	795	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110367

SMART Domains

Protein: ENSMUSP00000105996
Gene: ENSMUSG00000038143

Domain	Start	End	E-Value	Type
Pfam:Stork_head	1	79	5.6e-35	PFAM
low complexity region	163	174	N/A	INTRINSIC
low complexity region	290	315	N/A	INTRINSIC
low complexity region	397	411	N/A	INTRINSIC
low complexity region	592	612	N/A	INTRINSIC
low complexity region	655	669	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211737

Predicted Effect

probably benign
Transcript: ENSMUST00000211882

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Storkhead-box_winged-helix domain containing protein. This protein is differentially expressed in decidual tissue and may be involved in the susceptibility to pre-eclampsia with fetal growth restriction. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	A	G	1: 93,154,599	L266P	probably damaging	Het
Acr	A	G	15: 89,573,962	Y282C	probably damaging	Het
Alkbh4	A	G	5: 136,140,269	R136G	probably damaging	Het
Bptf	C	A	11: 107,047,340	E2*	probably null	Het
Cse1l	T	A	2: 166,939,913	F659Y	probably damaging	Het
Ctrc	A	T	4: 141,840,360	L144Q	probably damaging	Het
Elmo1	A	G	13: 20,286,732	I265V	probably benign	Het
Erich3	T	C	3: 154,713,916	S19P	probably benign	Het
Hmcn1	A	T	1: 150,664,878	C2893*	probably null	Het
Hnrnpll	G	A	17: 80,038,723	Q370*	probably null	Het
Itpkb	T	C	1: 180,332,494	S62P	probably damaging	Het
Lig3	T	A	11: 82,792,076	C501S	probably benign	Het
Nrxn1	C	T	17: 91,088,536	R64H	possibly damaging	Het
Ogfod2	T	G	5: 124,114,883	C319G	probably damaging	Het
Olfr1474	A	G	19: 13,471,422	I109V	probably benign	Het
Olfr201	T	C	16: 59,269,109	N186S	probably benign	Het
Olfr555	A	T	7: 102,659,034	D71V	probably damaging	Het
Olfr827	A	G	10: 130,210,860	V90A	probably benign	Het
Pabpc6	C	A	17: 9,669,373	R83L	probably damaging	Het
Pcdhgb2	A	T	18: 37,690,634	Q226L	probably benign	Het
Pole	A	T	5: 110,312,734	I1127F	probably damaging	Het
Psg22	A	T	7: 18,719,746	Q161L	possibly damaging	Het
Slc17a7	A	T	7: 45,168,788	T46S	probably benign	Het
Smad4	A	G	18: 73,641,810	S473P	probably damaging	Het
Snap47	T	A	11: 59,438,354	T41S	probably benign	Het
Snx21	T	C	2: 164,786,737	L100P	probably benign	Het
Stc1	T	A	14: 69,038,395	N212K	probably benign	Het
Stk32a	A	T	18: 43,315,144	N396I	possibly damaging	Het
Trav16d-dv11	A	G	14: 53,047,287	M1V	probably null	Het
Trim33	T	C	3: 103,311,515		probably null	Het
Tyrp1	T	C	4: 80,840,670	V260A	probably benign	Het
Ush2a	T	C	1: 188,911,064	Y4208H	probably damaging	Het
Vmn1r25	T	A	6: 57,979,080	K75*	probably null	Het
Vmn2r117	T	A	17: 23,479,407	N64I	possibly damaging	Het
Wdfy4	C	T	14: 32,973,535		probably null	Het
Wnt8a	A	T	18: 34,545,516	I128F	probably damaging	Het
Zc3h7b	C	A	15: 81,779,260	Y484*	probably null	Het
Zfp619	A	G	7: 39,535,221	K225R	probably benign	Het

Other mutations in Stox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02234:Stox2	APN	8	47193612	missense	probably damaging	1.00
IGL02331:Stox2	APN	8	47191944	missense	probably damaging	0.96
IGL02399:Stox2	APN	8	47186538	missense	probably damaging	0.99
IGL03091:Stox2	APN	8	47193187	missense	possibly damaging	0.66
IGL03143:Stox2	APN	8	47193804	missense	possibly damaging	0.78
IGL03307:Stox2	APN	8	47194030	missense	probably damaging	1.00
R0082:Stox2	UTSW	8	47203282	splice site	probably benign
R0313:Stox2	UTSW	8	47192134	missense	probably damaging	1.00
R0382:Stox2	UTSW	8	47203284	splice site	probably benign
R0513:Stox2	UTSW	8	47193865	missense	probably damaging	1.00
R0539:Stox2	UTSW	8	47194035	missense	probably damaging	0.97
R0920:Stox2	UTSW	8	47193018	missense	probably damaging	1.00
R1764:Stox2	UTSW	8	47194016	nonsense	probably null
R1923:Stox2	UTSW	8	47193626	missense	probably damaging	1.00
R2311:Stox2	UTSW	8	47191978	missense	probably damaging	1.00
R3196:Stox2	UTSW	8	47192830	missense	probably damaging	0.99
R3715:Stox2	UTSW	8	47413152	missense	possibly damaging	0.90
R4300:Stox2	UTSW	8	47193992	nonsense	probably null
R4534:Stox2	UTSW	8	47193379	missense	probably damaging	1.00
R4600:Stox2	UTSW	8	47192935	missense	probably damaging	1.00
R4601:Stox2	UTSW	8	47192935	missense	probably damaging	1.00
R4602:Stox2	UTSW	8	47192935	missense	probably damaging	1.00
R4603:Stox2	UTSW	8	47192935	missense	probably damaging	1.00
R4610:Stox2	UTSW	8	47192935	missense	probably damaging	1.00
R4624:Stox2	UTSW	8	47193816	missense	probably damaging	1.00
R4672:Stox2	UTSW	8	47192106	missense	probably damaging	1.00
R4888:Stox2	UTSW	8	47203163	missense	probably damaging	1.00
R4944:Stox2	UTSW	8	47413265	missense	possibly damaging	0.46
R5331:Stox2	UTSW	8	47413627	utr 5 prime	probably benign
R5349:Stox2	UTSW	8	47287916	missense	possibly damaging	0.70
R5367:Stox2	UTSW	8	47203225	missense	probably damaging	1.00
R5471:Stox2	UTSW	8	47193513	missense	probably damaging	0.96
R5561:Stox2	UTSW	8	47193006	missense	probably damaging	1.00
R5630:Stox2	UTSW	8	47191890	missense	probably damaging	1.00
R5719:Stox2	UTSW	8	47413137	nonsense	probably null
R5733:Stox2	UTSW	8	47413137	nonsense	probably null
R5996:Stox2	UTSW	8	47203147	missense	possibly damaging	0.93
R6170:Stox2	UTSW	8	47192020	missense	probably benign	0.02
R6458:Stox2	UTSW	8	47192044	missense	possibly damaging	0.66
R6786:Stox2	UTSW	8	47186465	missense	probably damaging	1.00
R6815:Stox2	UTSW	8	47193101	missense	probably damaging	1.00
R6951:Stox2	UTSW	8	47203132	missense	probably damaging	1.00
R7193:Stox2	UTSW	8	47186454	missense	probably benign
R7330:Stox2	UTSW	8	47192236	missense	possibly damaging	0.61
R7552:Stox2	UTSW	8	47203119	critical splice donor site	probably null
R8266:Stox2	UTSW	8	47192025	missense	probably damaging	0.99
R8506:Stox2	UTSW	8	47192073	missense	possibly damaging	0.79
R8935:Stox2	UTSW	8	47192860	missense	possibly damaging	0.66
R9261:Stox2	UTSW	8	47192406	missense	possibly damaging	0.78
R9325:Stox2	UTSW	8	47194060	missense	probably benign	0.45
R9505:Stox2	UTSW	8	47192269	missense	probably benign	0.28
X0027:Stox2	UTSW	8	47193840	missense	possibly damaging	0.95
Z1177:Stox2	UTSW	8	47194050	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCAACCTGTGCTTGAGATG -3'
(R):5'- GGAAGTCCATTAGCCCCATC -3'

Sequencing Primer
(F):5'- CCAACCTGTGCTTGAGATGTTTGTC -3'
(R):5'- GAAGTCCATTAGCCCCATCACTTG -3'

Posted On

2020-01-23