Incidental Mutation 'R8001:Olfr827'
ID616364
Institutional Source Beutler Lab
Gene Symbol Olfr827
Ensembl Gene ENSMUSG00000045559
Gene Nameolfactory receptor 827
SynonymsMOR210-5, GA_x6K02T2PULF-11878777-11877809
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R8001 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location130203049-130214403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130210860 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 90 (V90A)
Ref Sequence ENSEMBL: ENSMUSP00000149200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058123] [ENSMUST00000213568]
Predicted Effect probably benign
Transcript: ENSMUST00000058123
AA Change: V90A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089609
Gene: ENSMUSG00000045559
AA Change: V90A

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 6e-53 PFAM
Pfam:7tm_1 53 300 2.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213568
AA Change: V90A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A G 1: 93,154,599 L266P probably damaging Het
Acr A G 15: 89,573,962 Y282C probably damaging Het
Alkbh4 A G 5: 136,140,269 R136G probably damaging Het
Bptf C A 11: 107,047,340 E2* probably null Het
Cse1l T A 2: 166,939,913 F659Y probably damaging Het
Ctrc A T 4: 141,840,360 L144Q probably damaging Het
Elmo1 A G 13: 20,286,732 I265V probably benign Het
Erich3 T C 3: 154,713,916 S19P probably benign Het
Hmcn1 A T 1: 150,664,878 C2893* probably null Het
Hnrnpll G A 17: 80,038,723 Q370* probably null Het
Itpkb T C 1: 180,332,494 S62P probably damaging Het
Lig3 T A 11: 82,792,076 C501S probably benign Het
Nrxn1 C T 17: 91,088,536 R64H possibly damaging Het
Ogfod2 T G 5: 124,114,883 C319G probably damaging Het
Olfr1474 A G 19: 13,471,422 I109V probably benign Het
Olfr201 T C 16: 59,269,109 N186S probably benign Het
Olfr555 A T 7: 102,659,034 D71V probably damaging Het
Pabpc6 C A 17: 9,669,373 R83L probably damaging Het
Pcdhgb2 A T 18: 37,690,634 Q226L probably benign Het
Pole A T 5: 110,312,734 I1127F probably damaging Het
Psg22 A T 7: 18,719,746 Q161L possibly damaging Het
Slc17a7 A T 7: 45,168,788 T46S probably benign Het
Smad4 A G 18: 73,641,810 S473P probably damaging Het
Snap47 T A 11: 59,438,354 T41S probably benign Het
Snx21 T C 2: 164,786,737 L100P probably benign Het
Stc1 T A 14: 69,038,395 N212K probably benign Het
Stk32a A T 18: 43,315,144 N396I possibly damaging Het
Stox2 G A 8: 47,186,477 P894L probably benign Het
Trav16d-dv11 A G 14: 53,047,287 M1V probably null Het
Trim33 T C 3: 103,311,515 probably null Het
Tyrp1 T C 4: 80,840,670 V260A probably benign Het
Ush2a T C 1: 188,911,064 Y4208H probably damaging Het
Vmn1r25 T A 6: 57,979,080 K75* probably null Het
Vmn2r117 T A 17: 23,479,407 N64I possibly damaging Het
Wdfy4 C T 14: 32,973,535 probably null Het
Wnt8a A T 18: 34,545,516 I128F probably damaging Het
Zc3h7b C A 15: 81,779,260 Y484* probably null Het
Zfp619 A G 7: 39,535,221 K225R probably benign Het
Other mutations in Olfr827
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02351:Olfr827 APN 10 130210734 missense probably damaging 1.00
IGL02358:Olfr827 APN 10 130210734 missense probably damaging 1.00
R0179:Olfr827 UTSW 10 130210338 missense probably damaging 1.00
R0401:Olfr827 UTSW 10 130210620 missense probably damaging 1.00
R0607:Olfr827 UTSW 10 130211070 missense probably benign 0.33
R1139:Olfr827 UTSW 10 130211079 missense possibly damaging 0.53
R1462:Olfr827 UTSW 10 130210723 missense probably benign 0.30
R1462:Olfr827 UTSW 10 130210723 missense probably benign 0.30
R1645:Olfr827 UTSW 10 130210212 missense probably damaging 0.99
R4712:Olfr827 UTSW 10 130210422 missense possibly damaging 0.78
R4966:Olfr827 UTSW 10 130210437 missense probably benign 0.31
R5219:Olfr827 UTSW 10 130210924 missense possibly damaging 0.84
R6363:Olfr827 UTSW 10 130211037 missense possibly damaging 0.93
R6734:Olfr827 UTSW 10 130210257 missense probably benign 0.31
R6909:Olfr827 UTSW 10 130210753 missense probably benign
R7180:Olfr827 UTSW 10 130210942 missense probably benign 0.05
R7549:Olfr827 UTSW 10 130210984 missense probably benign 0.01
R7665:Olfr827 UTSW 10 130211261 intron probably null
Predicted Primers PCR Primer
(F):5'- TGGACACAGACACTCCTTGAC -3'
(R):5'- CTGACTTCATTCTTGTAGGCATCAG -3'

Sequencing Primer
(F):5'- CCTTGACATTCGAACGCTGTAAAGG -3'
(R):5'- CATTCTTGTAGGCATCAGAGTCCG -3'
Posted On2020-01-23