Incidental Mutation 'R8023:Olfr1183'
ID617505
Institutional Source Beutler Lab
Gene Symbol Olfr1183
Ensembl Gene ENSMUSG00000049372
Gene Nameolfactory receptor 1183
SynonymsGA_x6K02T2Q125-49948903-49949814, MOR230-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88454867-88469199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88461678 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 132 (I132V)
Ref Sequence ENSEMBL: ENSMUSP00000154094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102618] [ENSMUST00000213115] [ENSMUST00000219871]
Predicted Effect probably benign
Transcript: ENSMUST00000102618
AA Change: I113V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099678
Gene: ENSMUSG00000049372
AA Change: I113V

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 32 299 1.8e-5 PFAM
Pfam:7tm_1 38 284 1.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213115
AA Change: I132V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000219871
AA Change: I113V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Olfr1183
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr1183 APN 2 88461352 missense probably benign
IGL01150:Olfr1183 APN 2 88462075 missense possibly damaging 0.93
IGL02894:Olfr1183 APN 2 88461726 missense probably damaging 1.00
R0382:Olfr1183 UTSW 2 88461725 missense possibly damaging 0.87
R0401:Olfr1183 UTSW 2 88461925 missense probably damaging 1.00
R0664:Olfr1183 UTSW 2 88462171 missense probably damaging 1.00
R1990:Olfr1183 UTSW 2 88461342 start codon destroyed probably null
R3122:Olfr1183 UTSW 2 88461509 missense probably damaging 0.99
R4596:Olfr1183 UTSW 2 88462194 missense probably benign 0.28
R7361:Olfr1183 UTSW 2 88461492 missense probably benign 0.28
R7469:Olfr1183 UTSW 2 88461347 missense probably benign
R7858:Olfr1183 UTSW 2 88461712 missense probably damaging 1.00
R7941:Olfr1183 UTSW 2 88461712 missense probably damaging 1.00
R8147:Olfr1183 UTSW 2 88462083 missense possibly damaging 0.93
Z1176:Olfr1183 UTSW 2 88462114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAACTTCCTCATCGTGATGAC -3'
(R):5'- TCACATTTGGGCCACAGAATG -3'

Sequencing Primer
(F):5'- TGAGTCAGACACTTGGGAGTCC -3'
(R):5'- CCACAGAATGGTAATCTTAAGGC -3'
Posted On2020-01-23