Incidental Mutation 'R8023:Agbl4'
ID617517
Institutional Source Beutler Lab
Gene Symbol Agbl4
Ensembl Gene ENSMUSG00000061298
Gene NameATP/GTP binding protein-like 4
Synonyms4931433A01Rik, 4930578N11Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location110397661-111664324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111617148 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 378 (V378E)
Ref Sequence ENSEMBL: ENSMUSP00000095533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080744] [ENSMUST00000097920] [ENSMUST00000106592]
Predicted Effect probably benign
Transcript: ENSMUST00000080744
AA Change: V378E

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079568
Gene: ENSMUSG00000061298
AA Change: V378E

DomainStartEndE-ValueType
Zn_pept 169 436 4.95e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097920
AA Change: V378E

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095533
Gene: ENSMUSG00000061298
AA Change: V378E

DomainStartEndE-ValueType
Zn_pept 169 465 3.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106592
AA Change: V378E

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102202
Gene: ENSMUSG00000061298
AA Change: V378E

DomainStartEndE-ValueType
Zn_pept 169 436 4.95e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000118551
Gene: ENSMUSG00000061298
AA Change: V223E

DomainStartEndE-ValueType
Zn_pept 15 267 9.65e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal platelet morphology and physiology, impaired megakaryopoiesis, increased spleen weight and increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Agbl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Agbl4 APN 4 111118884 missense probably damaging 1.00
IGL02961:Agbl4 APN 4 110580121 missense probably damaging 1.00
IGL03383:Agbl4 APN 4 111657423 intron probably benign
IGL03401:Agbl4 APN 4 111119019 missense probably damaging 0.99
I1329:Agbl4 UTSW 4 110478455 splice site probably benign
R0277:Agbl4 UTSW 4 111617222 missense probably damaging 1.00
R0323:Agbl4 UTSW 4 111617222 missense probably damaging 1.00
R0690:Agbl4 UTSW 4 111657388 missense probably benign 0.35
R1086:Agbl4 UTSW 4 110478594 splice site probably benign
R1099:Agbl4 UTSW 4 110955663 critical splice donor site probably null
R1172:Agbl4 UTSW 4 111656318 splice site probably benign
R1480:Agbl4 UTSW 4 111566717 missense possibly damaging 0.56
R1508:Agbl4 UTSW 4 111656398 missense probably benign 0.10
R1564:Agbl4 UTSW 4 110955564 splice site probably null
R1610:Agbl4 UTSW 4 111657168 missense probably benign 0.00
R1869:Agbl4 UTSW 4 111566629 missense possibly damaging 0.91
R1989:Agbl4 UTSW 4 111566682 missense possibly damaging 0.92
R2327:Agbl4 UTSW 4 111526601 missense probably benign 0.00
R4780:Agbl4 UTSW 4 111657331 missense possibly damaging 0.73
R4806:Agbl4 UTSW 4 110955637 missense probably damaging 1.00
R4814:Agbl4 UTSW 4 111656368 missense possibly damaging 0.60
R5077:Agbl4 UTSW 4 111566742 missense probably benign 0.00
R5079:Agbl4 UTSW 4 111566629 missense possibly damaging 0.91
R5091:Agbl4 UTSW 4 111119040 missense possibly damaging 0.79
R5124:Agbl4 UTSW 4 111656328 missense probably benign 0.21
R5297:Agbl4 UTSW 4 111566698 missense possibly damaging 0.92
R5645:Agbl4 UTSW 4 111657330 missense possibly damaging 0.53
R5996:Agbl4 UTSW 4 110955672 unclassified probably null
R6363:Agbl4 UTSW 4 111566785 intron probably benign
R6492:Agbl4 UTSW 4 111547272 missense probably damaging 1.00
R6617:Agbl4 UTSW 4 110580135 missense probably damaging 1.00
R6709:Agbl4 UTSW 4 111566782 intron probably benign
R6873:Agbl4 UTSW 4 111566659 missense possibly damaging 0.76
R7015:Agbl4 UTSW 4 110478500 missense probably damaging 1.00
R7105:Agbl4 UTSW 4 111566723 missense probably benign 0.06
R7143:Agbl4 UTSW 4 111617136 missense probably damaging 1.00
R7413:Agbl4 UTSW 4 111657298 missense probably benign 0.23
R7489:Agbl4 UTSW 4 111526658 missense probably damaging 1.00
R7583:Agbl4 UTSW 4 111118953 missense possibly damaging 0.89
R7796:Agbl4 UTSW 4 110660968 missense unknown
R8058:Agbl4 UTSW 4 110660842 missense unknown
Z1176:Agbl4 UTSW 4 110660839 missense probably damaging 1.00
Z1176:Agbl4 UTSW 4 111526643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCACTGAGATTCCTGC -3'
(R):5'- ATGAAGGCTGGTCTAGATATAGTGG -3'

Sequencing Primer
(F):5'- AGGAACCCTGATGGATGCTTTC -3'
(R):5'- GGATCTAGCAAGGATACAGGCTTC -3'
Posted On2020-01-23