Incidental Mutation 'R8025:Vps33a'
ID617640
Institutional Source Beutler Lab
Gene Symbol Vps33a
Ensembl Gene ENSMUSG00000029434
Gene NameVPS33A CORVET/HOPS core subunit
Synonyms3830421M04Rik, bf
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8025 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location123528659-123573038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123558675 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 305 (N305S)
Ref Sequence ENSEMBL: ENSMUSP00000031388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031388]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031388
AA Change: N305S

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: N305S

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Sec1 34 592 7.2e-104 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik T G 3: 79,629,328 L51R probably damaging Het
Actl7b T C 4: 56,741,137 T74A probably damaging Het
Aip C A 19: 4,115,346 A207S probably benign Het
AL732309.1 A G 2: 25,246,319 probably benign Het
Apcdd1 G T 18: 62,936,908 C82F probably damaging Het
Arhgap42 T G 9: 9,005,822 I736L probably benign Het
Armc4 A T 18: 7,127,224 N996K probably benign Het
Baz1a A T 12: 54,909,136 I1056N probably benign Het
Bzw2 T C 12: 36,107,518 E316G probably damaging Het
Carns1 A T 19: 4,166,506 I559N probably damaging Het
Ccdc144b C A 3: 36,018,987 R382L probably damaging Het
Chrnb2 A T 3: 89,761,342 V222E probably damaging Het
Cngb3 A T 4: 19,280,960 N10Y possibly damaging Het
Dennd1b A G 1: 139,110,420 K267E Het
Dhx32 A G 7: 133,721,371 Y705H probably damaging Het
Dnah7c G A 1: 46,457,296 V114I probably benign Het
Dnah8 T A 17: 30,741,337 C2229* probably null Het
Gm14401 T C 2: 177,086,456 F112L probably damaging Het
Gm9573 GTGCTGGATTCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAGCCACTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA GTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA 17: 35,620,987 probably benign Het
Habp4 G A 13: 64,174,831 R238H probably benign Het
Herpud1 A G 8: 94,392,521 Y301C probably damaging Het
Itih5 G A 2: 10,241,022 A641T probably benign Het
Kcns3 A T 12: 11,091,845 N284K probably damaging Het
Mcrs1 G A 15: 99,246,933 Q267* probably null Het
Midn G A 10: 80,155,292 A379T probably benign Het
Olfr1028 A T 2: 85,951,512 I150F probably benign Het
Olfr462 A T 11: 87,888,951 probably null Het
Olfr561 T C 7: 102,775,256 V244A probably benign Het
Olfr716 A G 7: 107,147,723 M136V possibly damaging Het
Olfr869 T C 9: 20,137,632 V172A probably benign Het
Parpbp T C 10: 88,093,108 D490G probably benign Het
Pcbp2 T A 15: 102,488,276 S262R probably benign Het
Pcdhgc5 T C 18: 37,820,939 I422T possibly damaging Het
Pcsk5 T A 19: 17,561,051 probably benign Het
Plxna1 G A 6: 89,331,272 R1278W probably damaging Het
Polr1c A G 17: 46,245,048 L162P probably damaging Het
Rasl2-9 A G 7: 5,125,482 S150P probably damaging Het
Raver2 C A 4: 101,102,965 S214* probably null Het
Rbpjl C A 2: 164,410,246 probably benign Het
Rec114 T G 9: 58,660,322 E127A possibly damaging Het
Recql5 C A 11: 115,928,112 L209F probably damaging Het
Rgs11 T C 17: 26,204,385 probably null Het
Rgs3 C A 4: 62,690,594 H366N probably damaging Het
Rnf148 C T 6: 23,654,197 D267N possibly damaging Het
Scn1a T C 2: 66,318,213 N1007S probably benign Het
Sdcbp A G 4: 6,393,022 T220A probably benign Het
Sema5a A G 15: 32,548,782 N134S probably benign Het
Smg1 G A 7: 118,206,989 Q210* probably null Het
Snx7 A G 3: 117,832,877 V328A probably benign Het
Sult1c2 A T 17: 53,831,809 S247T probably benign Het
Tceanc2 C T 4: 107,139,800 probably null Het
Tead3 T C 17: 28,335,035 D141G probably benign Het
Tmem136 T A 9: 43,111,553 T169S probably benign Het
Ube3b T C 5: 114,408,209 M692T probably damaging Het
Vmn1r188 T C 13: 22,087,914 F13L probably benign Het
Vmn2r3 A G 3: 64,275,450 V276A possibly damaging Het
Vmn2r57 A G 7: 41,426,759 I443T probably benign Het
Vps33b A T 7: 80,290,346 probably benign Het
Wdr34 T C 2: 30,048,718 Q51R probably benign Het
Wdr72 T A 9: 74,143,499 M91K probably benign Het
Xylb T C 9: 119,381,503 F351L probably damaging Het
Zan C T 5: 137,406,352 D3883N unknown Het
Zfp82 T A 7: 30,056,853 H268L probably damaging Het
Other mutations in Vps33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vps33a APN 5 123572943 missense probably benign 0.00
IGL01459:Vps33a APN 5 123535308 missense probably benign 0.08
IGL02473:Vps33a APN 5 123569571 missense probably damaging 1.00
IGL02899:Vps33a APN 5 123531176 missense probably damaging 1.00
R0498:Vps33a UTSW 5 123570961 missense probably benign 0.40
R1134:Vps33a UTSW 5 123570912 missense probably damaging 0.97
R1928:Vps33a UTSW 5 123558621 missense probably benign 0.02
R2012:Vps33a UTSW 5 123531181 splice site probably null
R2926:Vps33a UTSW 5 123569571 missense possibly damaging 0.83
R3688:Vps33a UTSW 5 123535211 splice site probably null
R3872:Vps33a UTSW 5 123531192 missense probably benign 0.16
R4437:Vps33a UTSW 5 123531884 missense probably benign
R5153:Vps33a UTSW 5 123558628 missense probably damaging 1.00
R5396:Vps33a UTSW 5 123558630 missense probably damaging 0.98
R5686:Vps33a UTSW 5 123547001 critical splice donor site probably null
R5714:Vps33a UTSW 5 123569500 missense probably benign
R5814:Vps33a UTSW 5 123565056 missense probably damaging 1.00
R6845:Vps33a UTSW 5 123535272 missense probably benign 0.02
R7183:Vps33a UTSW 5 123535215 missense probably null 0.83
R7359:Vps33a UTSW 5 123558633 missense probably benign 0.00
R7593:Vps33a UTSW 5 123536556 missense probably benign 0.00
R7855:Vps33a UTSW 5 123570979 missense possibly damaging 0.78
R7885:Vps33a UTSW 5 123535249 missense possibly damaging 0.70
R8139:Vps33a UTSW 5 123533952 missense probably benign 0.04
R8275:Vps33a UTSW 5 123569459 missense probably damaging 0.99
R8434:Vps33a UTSW 5 123533881 missense possibly damaging 0.74
R8845:Vps33a UTSW 5 123571475 critical splice donor site probably null
R8879:Vps33a UTSW 5 123533899 missense probably damaging 1.00
R8880:Vps33a UTSW 5 123569443 missense probably damaging 0.98
X0026:Vps33a UTSW 5 123547097 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGTTTGAGGACCTTTAATTTCCAAGG -3'
(R):5'- TGCTCAAGCGTGTGTGCTC -3'

Sequencing Primer
(F):5'- CTTTACAAGTCAGCATGCATGGGC -3'
(R):5'- GCTCCAACTCCAGGTTATGTGAAG -3'
Posted On2020-01-23