Incidental Mutation 'R0659:Olfr970'
ID61791
Institutional Source Beutler Lab
Gene Symbol Olfr970
Ensembl Gene ENSMUSG00000095774
Gene Nameolfactory receptor 970
SynonymsMOR171-16, GA_x6K02T2PVTD-33517322-33518257
MMRRC Submission 038844-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R0659 (G1)
Quality Score81
Status Validated
Chromosome9
Chromosomal Location39808860-39820997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 39819816 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 59 (M59R)
Ref Sequence ENSEMBL: ENSMUSP00000150325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071132] [ENSMUST00000213975] [ENSMUST00000215922]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071132
AA Change: M59R

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071132
Gene: ENSMUSG00000095774
AA Change: M59R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.2e-53 PFAM
Pfam:7tm_1 41 290 1.6e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213975
AA Change: M59R

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215265
Predicted Effect possibly damaging
Transcript: ENSMUST00000215922
AA Change: M59R

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,007,493 probably benign Het
Ahnak A G 19: 9,015,002 H4550R possibly damaging Het
Anxa6 A G 11: 54,983,347 V591A probably damaging Het
Apol7c A G 15: 77,526,273 S158P probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
Cacna2d4 A G 6: 119,345,106 probably benign Het
Cd109 T C 9: 78,680,170 probably benign Het
Cep78 C T 19: 15,956,190 V675M probably damaging Het
Ces4a T C 8: 105,144,922 probably benign Het
Chpf A G 1: 75,477,723 V137A probably damaging Het
Comp T C 8: 70,379,101 S457P possibly damaging Het
Cth A G 3: 157,920,115 probably benign Het
Cyp2a12 T C 7: 27,034,138 L314P probably damaging Het
Ets1 C T 9: 32,738,293 R309C probably damaging Het
Fam208b T C 13: 3,574,448 D1834G probably damaging Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gm9875 T G 2: 13,558,184 F108V unknown Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Greb1 T C 12: 16,680,212 Y1738C probably damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Hdac5 A T 11: 102,196,024 V70E probably damaging Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hsd17b3 T C 13: 64,073,936 T92A possibly damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Lin28a T C 4: 134,008,099 probably benign Het
Mapk6 T C 9: 75,397,962 S58G probably damaging Het
Mmp21 G A 7: 133,677,667 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Mto1 T A 9: 78,457,508 I343N probably damaging Het
Mto1 C T 9: 78,470,790 T638M probably damaging Het
Myo18b T C 5: 112,760,327 K2027E possibly damaging Het
Myo7a T C 7: 98,054,338 probably benign Het
Nlrp9a T C 7: 26,557,278 I107T probably damaging Het
Olfr181 C A 16: 58,926,409 R54L possibly damaging Het
Osbpl5 A G 7: 143,705,030 S268P probably damaging Het
Pih1d1 T A 7: 45,159,975 S289T probably benign Het
Pik3c2b A G 1: 133,071,200 D353G probably damaging Het
Ppef2 A G 5: 92,230,509 L609P probably damaging Het
Prune2 A T 19: 17,122,835 D1901V probably damaging Het
Rdh9 T C 10: 127,776,575 Y31H possibly damaging Het
Slc5a9 T A 4: 111,883,871 Y526F possibly damaging Het
Slitrk5 A G 14: 111,680,689 K582E probably benign Het
Sult1c2 A T 17: 53,831,778 M257K probably damaging Het
Tmem132d A G 5: 127,984,287 I417T possibly damaging Het
Tmem229b T C 12: 78,965,134 T8A probably benign Het
Tmem237 T C 1: 59,114,094 I89M possibly damaging Het
Tnfrsf17 A T 16: 11,319,819 D140V probably damaging Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Trio A G 15: 27,831,399 L194P probably damaging Het
Vmn2r74 T C 7: 85,955,914 probably benign Het
Vps13c T A 9: 67,920,935 M1457K probably benign Het
Zfhx2 A G 14: 55,073,801 C479R possibly damaging Het
Zfp420 T A 7: 29,875,539 C395S probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zranb2 A G 3: 157,541,763 S193G probably benign Het
Other mutations in Olfr970
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Olfr970 APN 9 39820002 missense probably damaging 1.00
IGL02674:Olfr970 APN 9 39819638 unclassified probably null
R0686:Olfr970 UTSW 9 39819668 missense probably damaging 0.98
R1952:Olfr970 UTSW 9 39820067 missense probably benign 0.09
R2068:Olfr970 UTSW 9 39820550 missense probably benign 0.00
R4472:Olfr970 UTSW 9 39820574 makesense probably null
R4798:Olfr970 UTSW 9 39819897 missense probably benign 0.13
R5035:Olfr970 UTSW 9 39820094 missense possibly damaging 0.82
R5339:Olfr970 UTSW 9 39819933 missense probably damaging 0.97
R6751:Olfr970 UTSW 9 39819897 missense probably benign 0.13
R7211:Olfr970 UTSW 9 39819858 missense possibly damaging 0.76
R7471:Olfr970 UTSW 9 39820127 missense probably benign 0.00
R7609:Olfr970 UTSW 9 39820287 missense probably benign
R7638:Olfr970 UTSW 9 39819893 missense probably damaging 1.00
R7890:Olfr970 UTSW 9 39820014 missense probably damaging 0.99
R7973:Olfr970 UTSW 9 39820014 missense probably damaging 0.99
Z1176:Olfr970 UTSW 9 39820355 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACACTCCTTAGCAGACTCCAC -3'
(R):5'- AGGGGTTACAGATTGCAACATAGCG -3'

Sequencing Primer
(F):5'- GTGTTAAGCAGTCCAATGCTTC -3'
(R):5'- TTGCAACATAGCGATCATATGCC -3'
Posted On2013-07-30