Mutagenetix > Incidental Mutations

Incidental Mutation 'R0659:Cacna2d4'

61781

Institutional Source

Beutler Lab

Gene Symbol

Cacna2d4

Ensembl Gene

ENSMUSG00000041460

Gene Name

calcium channel, voltage-dependent, alpha 2/delta subunit 4

Synonyms

5730412N02Rik

MMRRC Submission

038844-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0659 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

119236526-119352407 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 119345106 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037434] [ENSMUST00000186622]

AlphaFold

Q5RJF7

Predicted Effect

probably benign
Transcript: ENSMUST00000037434

SMART Domains

Protein: ENSMUSP00000044660
Gene: ENSMUSG00000041460

Domain	Start	End	E-Value	Type
Blast:WNT1	79	144	1e-13	BLAST
Pfam:VWA_N	155	271	7.3e-40	PFAM
VWA	296	481	4.37e-14	SMART
Pfam:Cache_1	494	586	1.1e-24	PFAM
low complexity region	837	849	N/A	INTRINSIC
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1000	1011	N/A	INTRINSIC
low complexity region	1120	1143	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185965

Predicted Effect

probably benign
Transcript: ENSMUST00000186622

SMART Domains

Protein: ENSMUSP00000140197
Gene: ENSMUSG00000041460

Domain	Start	End	E-Value	Type
Blast:WNT1	79	144	1e-13	BLAST
Pfam:VWA_N	155	271	6.4e-44	PFAM
VWA	296	481	2.7e-16	SMART
Pfam:Cache_1	494	559	1.1e-7	PFAM
low complexity region	812	824	N/A	INTRINSIC
low complexity region	950	959	N/A	INTRINSIC
low complexity region	975	986	N/A	INTRINSIC
low complexity region	1095	1118	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186702

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit severe loss of retinal signaling associated with abnormal photoreceptor ribbon synapses and cone-rod dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	A	G	18: 59,007,493		probably benign	Het
Ahnak	A	G	19: 9,015,002	H4550R	possibly damaging	Het
Anxa6	A	G	11: 54,983,347	V591A	probably damaging	Het
Apol7c	A	G	15: 77,526,273	S158P	probably damaging	Het
Asxl1	T	A	2: 153,400,724	S1065T	possibly damaging	Het
Cd109	T	C	9: 78,680,170		probably benign	Het
Cep78	C	T	19: 15,956,190	V675M	probably damaging	Het
Ces4a	T	C	8: 105,144,922		probably benign	Het
Chpf	A	G	1: 75,477,723	V137A	probably damaging	Het
Comp	T	C	8: 70,379,101	S457P	possibly damaging	Het
Cth	A	G	3: 157,920,115		probably benign	Het
Cyp2a12	T	C	7: 27,034,138	L314P	probably damaging	Het
Ets1	C	T	9: 32,738,293	R309C	probably damaging	Het
Fam208b	T	C	13: 3,574,448	D1834G	probably damaging	Het
Foxp2	T	C	6: 15,254,279		probably benign	Het
Gm9875	T	G	2: 13,558,184	F108V	unknown	Het
Golga5	G	T	12: 102,476,208	V269F	possibly damaging	Het
Greb1	T	C	12: 16,680,212	Y1738C	probably damaging	Het
Grin2a	G	T	16: 9,992,472	P21Q	probably damaging	Het
Hdac5	A	T	11: 102,196,024	V70E	probably damaging	Het
Hdac9	T	C	12: 34,437,222	Q60R	probably damaging	Het
Hsd17b3	T	C	13: 64,073,936	T92A	possibly damaging	Het
Itpk1	C	T	12: 102,606,078		probably benign	Het
Lin28a	T	C	4: 134,008,099		probably benign	Het
Mapk6	T	C	9: 75,397,962	S58G	probably damaging	Het
Mmp21	G	A	7: 133,677,667		probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Mroh2a	G	A	1: 88,250,342	D1053N	probably damaging	Het
Msh3	T	C	13: 92,345,096	N303D	possibly damaging	Het
Mto1	T	A	9: 78,457,508	I343N	probably damaging	Het
Mto1	C	T	9: 78,470,790	T638M	probably damaging	Het
Myo18b	T	C	5: 112,760,327	K2027E	possibly damaging	Het
Myo7a	T	C	7: 98,054,338		probably benign	Het
Nlrp9a	T	C	7: 26,557,278	I107T	probably damaging	Het
Olfr181	C	A	16: 58,926,409	R54L	possibly damaging	Het
Olfr970	T	G	9: 39,819,816	M59R	possibly damaging	Het
Osbpl5	A	G	7: 143,705,030	S268P	probably damaging	Het
Pih1d1	T	A	7: 45,159,975	S289T	probably benign	Het
Pik3c2b	A	G	1: 133,071,200	D353G	probably damaging	Het
Ppef2	A	G	5: 92,230,509	L609P	probably damaging	Het
Prune2	A	T	19: 17,122,835	D1901V	probably damaging	Het
Rdh9	T	C	10: 127,776,575	Y31H	possibly damaging	Het
Slc5a9	T	A	4: 111,883,871	Y526F	possibly damaging	Het
Slitrk5	A	G	14: 111,680,689	K582E	probably benign	Het
Sult1c2	A	T	17: 53,831,778	M257K	probably damaging	Het
Tmem132d	A	G	5: 127,984,287	I417T	possibly damaging	Het
Tmem229b	T	C	12: 78,965,134	T8A	probably benign	Het
Tmem237	T	C	1: 59,114,094	I89M	possibly damaging	Het
Tnfrsf17	A	T	16: 11,319,819	D140V	probably damaging	Het
Tnrc6b	T	A	15: 80,923,446		probably benign	Het
Trio	A	G	15: 27,831,399	L194P	probably damaging	Het
Vmn2r74	T	C	7: 85,955,914		probably benign	Het
Vps13c	T	A	9: 67,920,935	M1457K	probably benign	Het
Zfhx2	A	G	14: 55,073,801	C479R	possibly damaging	Het
Zfp420	T	A	7: 29,875,539	C395S	probably damaging	Het
Zfp740	A	G	15: 102,212,659	T136A	possibly damaging	Het
Zfp82	C	T	7: 30,056,329	E443K	probably damaging	Het
Zranb2	A	G	3: 157,541,763	S193G	probably benign	Het

Other mutations in Cacna2d4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Cacna2d4	APN	6	119337933	splice site	probably benign
IGL00469:Cacna2d4	APN	6	119268278	missense	probably damaging	1.00
IGL00518:Cacna2d4	APN	6	119343575	missense	probably damaging	1.00
IGL00946:Cacna2d4	APN	6	119271915	missense	possibly damaging	0.82
IGL01447:Cacna2d4	APN	6	119242904	missense	probably damaging	1.00
IGL01514:Cacna2d4	APN	6	119282173	splice site	probably benign
IGL01576:Cacna2d4	APN	6	119281641	nonsense	probably null
IGL01934:Cacna2d4	APN	6	119308768	missense	probably damaging	1.00
IGL02231:Cacna2d4	APN	6	119277908	splice site	probably benign
IGL02516:Cacna2d4	APN	6	119271870	splice site	probably benign
IGL02688:Cacna2d4	APN	6	119270749	splice site	probably null
IGL03110:Cacna2d4	APN	6	119236737	missense	probably benign	0.05
IGL03365:Cacna2d4	APN	6	119271264	missense	probably benign	0.15
saccharine	UTSW	6	119345106	splice site	probably benign
Steveo	UTSW	6	119347252	critical splice donor site	probably null
Sussmann	UTSW	6	119274318	missense	probably damaging	1.00
R0139:Cacna2d4	UTSW	6	119278269	intron	probably benign
R0157:Cacna2d4	UTSW	6	119312424	missense	probably benign	0.00
R0158:Cacna2d4	UTSW	6	119236748	missense	possibly damaging	0.68
R0245:Cacna2d4	UTSW	6	119308721	missense	probably damaging	1.00
R0612:Cacna2d4	UTSW	6	119281718	splice site	probably benign
R0722:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0743:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0833:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0835:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0836:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0884:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R1052:Cacna2d4	UTSW	6	119300333	missense	probably damaging	1.00
R1168:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R1170:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R1451:Cacna2d4	UTSW	6	119236824	missense	probably benign	0.01
R1564:Cacna2d4	UTSW	6	119241195	missense	possibly damaging	0.67
R1809:Cacna2d4	UTSW	6	119270824	missense	probably damaging	0.99
R1936:Cacna2d4	UTSW	6	119270761	missense	possibly damaging	0.82
R2078:Cacna2d4	UTSW	6	119338116	missense	probably benign	0.02
R2198:Cacna2d4	UTSW	6	119347259	splice site	probably benign
R2280:Cacna2d4	UTSW	6	119350041	missense	possibly damaging	0.85
R3757:Cacna2d4	UTSW	6	119241163	missense	probably damaging	0.98
R3975:Cacna2d4	UTSW	6	119278173	splice site	probably null
R3976:Cacna2d4	UTSW	6	119278173	splice site	probably null
R4238:Cacna2d4	UTSW	6	119240708	missense	probably null	1.00
R4591:Cacna2d4	UTSW	6	119298464	missense	probably benign	0.02
R4856:Cacna2d4	UTSW	6	119278256	missense	possibly damaging	0.90
R4899:Cacna2d4	UTSW	6	119268196	nonsense	probably null
R5319:Cacna2d4	UTSW	6	119347252	critical splice donor site	probably null
R5351:Cacna2d4	UTSW	6	119268201	missense	probably damaging	1.00
R5366:Cacna2d4	UTSW	6	119274318	missense	probably damaging	1.00
R5393:Cacna2d4	UTSW	6	119239054	missense	probably benign	0.20
R5395:Cacna2d4	UTSW	6	119271418	missense	possibly damaging	0.71
R5408:Cacna2d4	UTSW	6	119348791	missense	probably damaging	1.00
R5603:Cacna2d4	UTSW	6	119244285	missense	probably damaging	1.00
R5661:Cacna2d4	UTSW	6	119343531	missense	probably benign
R5898:Cacna2d4	UTSW	6	119274231	missense	probably damaging	1.00
R5928:Cacna2d4	UTSW	6	119281698	missense	probably benign	0.06
R6186:Cacna2d4	UTSW	6	119281689	missense	possibly damaging	0.94
R6218:Cacna2d4	UTSW	6	119239060	missense	probably damaging	0.99
R6257:Cacna2d4	UTSW	6	119281619	critical splice acceptor site	probably null
R6409:Cacna2d4	UTSW	6	119282228	missense	probably damaging	0.99
R6931:Cacna2d4	UTSW	6	119282234	missense	possibly damaging	0.49
R7221:Cacna2d4	UTSW	6	119236663	missense	probably benign	0.02
R7363:Cacna2d4	UTSW	6	119343978	missense	probably damaging	1.00
R7371:Cacna2d4	UTSW	6	119308709	missense	probably benign	0.07
R7382:Cacna2d4	UTSW	6	119239087	missense	probably damaging	1.00
R7431:Cacna2d4	UTSW	6	119244276	missense	probably damaging	0.98
R7517:Cacna2d4	UTSW	6	119271921	missense	probably benign	0.01
R7527:Cacna2d4	UTSW	6	119271247	missense	probably benign	0.00
R7529:Cacna2d4	UTSW	6	119270766	missense	probably benign	0.01
R7710:Cacna2d4	UTSW	6	119274239	missense	probably benign	0.05
R7880:Cacna2d4	UTSW	6	119349155	missense	probably damaging	0.99
R8007:Cacna2d4	UTSW	6	119312444	missense	probably benign
R8084:Cacna2d4	UTSW	6	119300352	missense	probably damaging	1.00
R8159:Cacna2d4	UTSW	6	119297527	missense	probably benign	0.01
R8391:Cacna2d4	UTSW	6	119348745	missense	probably benign	0.04
R8700:Cacna2d4	UTSW	6	119281693	missense	probably damaging	1.00
R8857:Cacna2d4	UTSW	6	119271948	nonsense	probably null
R8973:Cacna2d4	UTSW	6	119241181	missense	probably damaging	1.00
R8976:Cacna2d4	UTSW	6	119338157	missense	possibly damaging	0.79
R8998:Cacna2d4	UTSW	6	119242915	missense	possibly damaging	0.90
R9129:Cacna2d4	UTSW	6	119336454	critical splice donor site	probably null
R9199:Cacna2d4	UTSW	6	119267826	missense	probably benign	0.12
R9228:Cacna2d4	UTSW	6	119271515	missense	probably benign	0.07
R9310:Cacna2d4	UTSW	6	119271953	critical splice donor site	probably null
R9315:Cacna2d4	UTSW	6	119236709	missense	probably benign
R9335:Cacna2d4	UTSW	6	119302053	missense	probably damaging	1.00
R9416:Cacna2d4	UTSW	6	119297518	missense	probably benign	0.06
RF023:Cacna2d4	UTSW	6	119268230	missense	probably benign	0.19
Z1176:Cacna2d4	UTSW	6	119312450	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- AGTGACCTAGAAGATAGCCTGGCTC -3'
(R):5'- CGAAGGTGTTCAGAGGTGATGTGAC -3'

Sequencing Primer
(F):5'- AGATAGCCTGGCTCCCTGG -3'
(R):5'- CGTCACACACAGAGGTAAGG -3'

Posted On

2013-07-30