Incidental Mutation 'R8042:Pabpc1'
ID618597
Institutional Source Beutler Lab
Gene Symbol Pabpc1
Ensembl Gene ENSMUSG00000022283
Gene Namepoly(A) binding protein, cytoplasmic 1
SynonymsPabp1, Pabpl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location36595661-36609668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36598309 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 447 (F447S)
Ref Sequence ENSEMBL: ENSMUSP00000001809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001809]
Predicted Effect probably benign
Transcript: ENSMUST00000001809
AA Change: F447S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001809
Gene: ENSMUSG00000022283
AA Change: F447S

DomainStartEndE-ValueType
RRM 12 85 6.86e-22 SMART
RRM 100 171 2.72e-25 SMART
RRM 192 264 5.39e-29 SMART
RRM 295 366 5.83e-25 SMART
low complexity region 455 462 N/A INTRINSIC
low complexity region 492 509 N/A INTRINSIC
PolyA 554 617 6.9e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155116
SMART Domains Protein: ENSMUSP00000117063
Gene: ENSMUSG00000022283

DomainStartEndE-ValueType
PolyA 36 99 6.9e-42 SMART
Meta Mutation Damage Score 0.2513 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a poly(A) binding protein. The protein shuttles between the nucleus and cytoplasm and binds to the 3' poly(A) tail of eukaryotic messenger RNAs via RNA-recognition motifs. The binding of this protein to poly(A) promotes ribosome recruitment and translation initiation; it is also required for poly(A) shortening which is the first step in mRNA decay. The gene is part of a small gene family including three protein-coding genes and several pseudogenes.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Pabpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01602:Pabpc1 APN 15 36599306 missense probably benign 0.36
IGL01605:Pabpc1 APN 15 36599306 missense probably benign 0.36
IGL01973:Pabpc1 APN 15 36599275 missense probably benign 0.13
R0309:Pabpc1 UTSW 15 36597493 missense possibly damaging 0.93
R0667:Pabpc1 UTSW 15 36598031 missense probably benign
R0883:Pabpc1 UTSW 15 36599054 unclassified probably benign
R1682:Pabpc1 UTSW 15 36605541 missense possibly damaging 0.75
R1749:Pabpc1 UTSW 15 36608340 missense probably damaging 1.00
R4731:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4732:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4733:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4825:Pabpc1 UTSW 15 36597011 missense probably damaging 0.98
R5324:Pabpc1 UTSW 15 36600625 missense probably damaging 1.00
R5328:Pabpc1 UTSW 15 36602877 missense probably benign 0.03
R5711:Pabpc1 UTSW 15 36605830 missense probably benign 0.03
R6073:Pabpc1 UTSW 15 36600651 missense probably damaging 0.97
R6751:Pabpc1 UTSW 15 36597534 missense possibly damaging 0.71
R7632:Pabpc1 UTSW 15 36597968 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACGTGGACCCATTGTCTGTG -3'
(R):5'- AACAAGCTGGGTTTCAGGAGC -3'

Sequencing Primer
(F):5'- GACCCATTGTCTGTGTTGATG -3'
(R):5'- TCAGGAGCACTTGGTGTTAC -3'
Posted On2020-01-23