Incidental Mutation 'R8042:Cep97'
ID618598
Institutional Source Beutler Lab
Gene Symbol Cep97
Ensembl Gene ENSMUSG00000022604
Gene Namecentrosomal protein 97
Synonyms4932439K18Rik, E130116N02Rik, Lrriq2, 2810403B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location55899888-55934855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55911602 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 608 (V608L)
Ref Sequence ENSEMBL: ENSMUSP00000023270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023270] [ENSMUST00000117468] [ENSMUST00000118500]
Predicted Effect probably benign
Transcript: ENSMUST00000023270
AA Change: V608L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023270
Gene: ENSMUSG00000022604
AA Change: V608L

DomainStartEndE-ValueType
Pfam:LRR_9 98 259 1.8e-12 PFAM
IQ 549 571 2e-1 SMART
coiled coil region 576 609 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 775 789 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117468
AA Change: V536L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112687
Gene: ENSMUSG00000022604
AA Change: V536L

DomainStartEndE-ValueType
Pfam:LRR_9 7 187 4.1e-12 PFAM
Pfam:LRR_8 30 86 1e-7 PFAM
Pfam:LRR_4 52 94 3.6e-8 PFAM
Pfam:LRR_1 53 73 1.3e-2 PFAM
IQ 477 499 2e-1 SMART
coiled coil region 504 537 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 703 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118500
AA Change: V536L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112663
Gene: ENSMUSG00000022604
AA Change: V536L

DomainStartEndE-ValueType
Pfam:LRR_9 7 187 4.1e-12 PFAM
Pfam:LRR_8 30 86 1e-7 PFAM
Pfam:LRR_4 52 94 3.6e-8 PFAM
Pfam:LRR_1 53 73 1.3e-2 PFAM
IQ 477 499 2e-1 SMART
coiled coil region 504 537 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 703 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Cep97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Cep97 APN 16 55924960 splice site probably benign
IGL01142:Cep97 APN 16 55922198 missense probably damaging 1.00
IGL01383:Cep97 APN 16 55911607 missense probably damaging 1.00
IGL01529:Cep97 APN 16 55930618 splice site probably benign
IGL01693:Cep97 APN 16 55930594 missense probably damaging 1.00
IGL01759:Cep97 APN 16 55930573 missense probably damaging 1.00
IGL02085:Cep97 APN 16 55915505 missense probably damaging 1.00
IGL02135:Cep97 APN 16 55922967 missense probably damaging 1.00
IGL02582:Cep97 APN 16 55922176 missense probably damaging 1.00
IGL02631:Cep97 APN 16 55922178 nonsense probably null
IGL02899:Cep97 APN 16 55918540 missense probably damaging 0.98
IGL03086:Cep97 APN 16 55915296 missense probably benign
R0067:Cep97 UTSW 16 55915561 missense possibly damaging 0.96
R0067:Cep97 UTSW 16 55915561 missense possibly damaging 0.96
R0309:Cep97 UTSW 16 55925058 missense probably damaging 0.96
R0504:Cep97 UTSW 16 55905779 missense probably benign 0.00
R0507:Cep97 UTSW 16 55905882 splice site probably benign
R0508:Cep97 UTSW 16 55930606 missense probably benign 0.02
R0658:Cep97 UTSW 16 55914902 missense probably benign 0.09
R1588:Cep97 UTSW 16 55927821 missense probably damaging 1.00
R1619:Cep97 UTSW 16 55927796 missense probably damaging 1.00
R1710:Cep97 UTSW 16 55915022 missense probably damaging 0.99
R1872:Cep97 UTSW 16 55927866 missense probably damaging 1.00
R1878:Cep97 UTSW 16 55905226 missense probably damaging 1.00
R1896:Cep97 UTSW 16 55927744 missense probably damaging 1.00
R5401:Cep97 UTSW 16 55924952 missense probably benign 0.03
R5520:Cep97 UTSW 16 55915296 missense probably benign
R5627:Cep97 UTSW 16 55924967 critical splice donor site probably null
R5632:Cep97 UTSW 16 55915583 missense probably benign 0.02
R5903:Cep97 UTSW 16 55919526 missense probably damaging 1.00
R5914:Cep97 UTSW 16 55905457 missense probably benign 0.02
R6185:Cep97 UTSW 16 55915092 missense probably benign
R6381:Cep97 UTSW 16 55922171 missense probably damaging 1.00
R7041:Cep97 UTSW 16 55905754 missense probably benign
R7056:Cep97 UTSW 16 55905572 missense probably damaging 1.00
R7371:Cep97 UTSW 16 55905320 missense probably benign 0.00
R7862:Cep97 UTSW 16 55905721 missense probably benign 0.26
R7951:Cep97 UTSW 16 55905457 missense probably benign 0.02
R8337:Cep97 UTSW 16 55915031 nonsense probably null
Z1176:Cep97 UTSW 16 55927735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTTCAAAGGACCACGGGCAG -3'
(R):5'- CAGACACATCTTATTTGGCTTCTG -3'

Sequencing Primer
(F):5'- GCAGGTCCGAGGGAACG -3'
(R):5'- ACACATCTTATTTGGCTTCTGTTTTG -3'
Posted On2020-01-23