Incidental Mutation 'R8042:Tert'
ID618593
Institutional Source Beutler Lab
Gene Symbol Tert
Ensembl Gene ENSMUSG00000021611
Gene Nametelomerase reverse transcriptase
SynonymsTR
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.624) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73626911-73649843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73627145 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 39 (V39E)
Ref Sequence ENSEMBL: ENSMUSP00000022104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022104] [ENSMUST00000221522] [ENSMUST00000223303]
Predicted Effect probably damaging
Transcript: ENSMUST00000022104
AA Change: V39E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022104
Gene: ENSMUSG00000021611
AA Change: V39E

DomainStartEndE-ValueType
Blast:Telomerase_RBD 329 375 2e-6 BLAST
Telomerase_RBD 449 584 5.02e-75 SMART
Blast:Telomerase_RBD 651 688 1e-5 BLAST
Pfam:RVT_1 787 918 6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221522
AA Change: V39E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000223303
AA Change: V39E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of impaired telomerase function, homozygous mutant mice are overtly normal in early generations. Impaired fertility has been reported in later generations for homozygotes of at least one knockout allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Tert
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Tert APN 13 73628297 missense possibly damaging 0.76
IGL01585:Tert APN 13 73634344 missense probably benign 0.15
IGL03167:Tert APN 13 73640000 missense probably damaging 1.00
FR4304:Tert UTSW 13 73648302 utr 3 prime probably benign
FR4342:Tert UTSW 13 73648300 utr 3 prime probably benign
FR4589:Tert UTSW 13 73648304 utr 3 prime probably benign
PIT4377001:Tert UTSW 13 73628261 missense possibly damaging 0.54
R0372:Tert UTSW 13 73648991 missense probably damaging 1.00
R0433:Tert UTSW 13 73627081 missense probably damaging 1.00
R0829:Tert UTSW 13 73644385 missense probably damaging 1.00
R1023:Tert UTSW 13 73642059 missense probably benign 0.41
R1236:Tert UTSW 13 73636379 missense probably damaging 0.99
R1331:Tert UTSW 13 73648354 missense probably damaging 1.00
R1426:Tert UTSW 13 73642353 splice site probably benign
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1521:Tert UTSW 13 73642056 missense probably damaging 1.00
R2484:Tert UTSW 13 73647985 missense probably benign
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R4428:Tert UTSW 13 73627475 missense probably damaging 1.00
R4430:Tert UTSW 13 73627475 missense probably damaging 1.00
R4431:Tert UTSW 13 73627475 missense probably damaging 1.00
R4630:Tert UTSW 13 73648991 missense probably damaging 1.00
R4696:Tert UTSW 13 73627820 missense probably benign 0.25
R4751:Tert UTSW 13 73628063 missense possibly damaging 0.89
R4926:Tert UTSW 13 73648389 missense possibly damaging 0.62
R5011:Tert UTSW 13 73646309 critical splice donor site probably null
R5013:Tert UTSW 13 73646309 critical splice donor site probably null
R5061:Tert UTSW 13 73634278 missense probably damaging 1.00
R5268:Tert UTSW 13 73627354 missense probably damaging 1.00
R5323:Tert UTSW 13 73648371 missense probably benign 0.07
R5396:Tert UTSW 13 73639243 missense probably damaging 0.97
R5445:Tert UTSW 13 73644284 missense probably benign 0.00
R5680:Tert UTSW 13 73642351 splice site probably null
R5688:Tert UTSW 13 73639156 missense probably damaging 1.00
R6092:Tert UTSW 13 73628581 missense probably benign 0.34
R6973:Tert UTSW 13 73627988 missense probably benign 0.02
R7069:Tert UTSW 13 73628410 missense probably damaging 0.99
R7317:Tert UTSW 13 73642376 missense probably damaging 1.00
R7747:Tert UTSW 13 73627606 missense probably damaging 1.00
R7787:Tert UTSW 13 73648932 missense probably damaging 0.99
R7846:Tert UTSW 13 73628195 missense probably damaging 1.00
R7994:Tert UTSW 13 73648955 missense probably benign 0.20
R8044:Tert UTSW 13 73635449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCACACCCTTGCATCTTG -3'
(R):5'- CAGCTCTTTCAGGGATGACACC -3'

Sequencing Primer
(F):5'- ATCTTGGTTCCCGCACGTG -3'
(R):5'- GTCTTGACACATGAGCTAGACGC -3'
Posted On2020-01-23