Incidental Mutation 'R8059:Plod1'
ID619588
Institutional Source Beutler Lab
Gene Symbol Plod1
Ensembl Gene ENSMUSG00000019055
Gene Nameprocollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
SynonymsLH1, 2410042F05Rik, lysyl hydroxylase 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location147909753-147936767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 147928484 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 207 (I207N)
Ref Sequence ENSEMBL: ENSMUSP00000019199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019199] [ENSMUST00000105712]
Predicted Effect probably damaging
Transcript: ENSMUST00000019199
AA Change: I207N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019199
Gene: ENSMUSG00000019055
AA Change: I207N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Blast:P4Hc 444 492 1e-8 BLAST
P4Hc 554 727 4.87e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105712
AA Change: I207N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101337
Gene: ENSMUSG00000019055
AA Change: I207N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lysyl hydroxylase is a membrane-bound homodimeric protein localized to the cisternae of the endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VI have deficiencies in lysyl hydroxylase activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit hypotonia, reduced voluntary movement, abnormal aorta and skin collagen fibers, irregular vascular smooth muscle and premature death associated with thoracic cavity hemorrhage and aortic dissection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rgs3 T C 4: 62,602,977 probably benign Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Plod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Plod1 APN 4 147932754 missense probably benign 0.12
IGL02312:Plod1 APN 4 147926157 missense probably benign 0.09
IGL02588:Plod1 APN 4 147913290 nonsense probably null
IGL02712:Plod1 APN 4 147918887 missense possibly damaging 0.95
IGL02976:Plod1 APN 4 147913321 missense probably damaging 0.99
IGL03244:Plod1 APN 4 147923123 critical splice donor site probably null
R0393:Plod1 UTSW 4 147918841 missense probably null 0.35
R1216:Plod1 UTSW 4 147921127 missense probably damaging 0.98
R1897:Plod1 UTSW 4 147926200 missense probably damaging 0.97
R3776:Plod1 UTSW 4 147931277 missense possibly damaging 0.75
R3923:Plod1 UTSW 4 147915823 missense possibly damaging 0.62
R4718:Plod1 UTSW 4 147916244 intron probably benign
R4897:Plod1 UTSW 4 147920279 missense probably benign
R5173:Plod1 UTSW 4 147916301 intron probably benign
R5657:Plod1 UTSW 4 147918781 missense possibly damaging 0.46
R6298:Plod1 UTSW 4 147916315 intron probably benign
R6995:Plod1 UTSW 4 147916218 intron probably benign
R7176:Plod1 UTSW 4 147913287 missense probably benign 0.00
R7632:Plod1 UTSW 4 147927024 missense probably damaging 1.00
R8167:Plod1 UTSW 4 147920201 missense probably damaging 1.00
R8804:Plod1 UTSW 4 147913321 missense probably damaging 0.99
R8909:Plod1 UTSW 4 147927106 nonsense probably null
X0013:Plod1 UTSW 4 147927042 missense possibly damaging 0.70
Y5406:Plod1 UTSW 4 147931187 missense probably damaging 1.00
Y5408:Plod1 UTSW 4 147931187 missense probably damaging 1.00
Z1176:Plod1 UTSW 4 147923200 missense probably damaging 0.99
Z1177:Plod1 UTSW 4 147931721 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGGAGGAGTCACTTGGTTTTC -3'
(R):5'- TAGAATGTGGCAGGCTGAGC -3'

Sequencing Primer
(F):5'- TCTGAAAACCTTCAACTCCTTCCAG -3'
(R):5'- TGGCAGGCTGAGCTAGTGC -3'
Posted On2020-01-23