Incidental Mutation 'R8059:Cers2'
ID619583
Institutional Source Beutler Lab
Gene Symbol Cers2
Ensembl Gene ENSMUSG00000015714
Gene Nameceramide synthase 2
SynonymsTrh3, 0610013I17Rik, Lass2, CerS2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95314791-95323599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95322671 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 342 (D342G)
Ref Sequence ENSEMBL: ENSMUSP00000015858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015841] [ENSMUST00000015858] [ENSMUST00000107170] [ENSMUST00000107171] [ENSMUST00000129267] [ENSMUST00000139498] [ENSMUST00000139866]
Predicted Effect probably benign
Transcript: ENSMUST00000015841
SMART Domains Protein: ENSMUSP00000015841
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000015858
AA Change: D342G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015858
Gene: ENSMUSG00000015714
AA Change: D342G

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 332 1.17e-81 SMART
low complexity region 337 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107170
SMART Domains Protein: ENSMUSP00000102788
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107171
SMART Domains Protein: ENSMUSP00000102789
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 528 567 N/A INTRINSIC
MBD 614 689 4.63e-33 SMART
PreSET 696 803 1.75e-41 SMART
SET 820 1288 1.76e-41 SMART
PostSET 1291 1307 1.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129267
SMART Domains Protein: ENSMUSP00000121110
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
transmembrane domain 136 155 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139498
SMART Domains Protein: ENSMUSP00000122672
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
Pfam:Homeobox 65 127 5.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139866
SMART Domains Protein: ENSMUSP00000120190
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 246 4.28e-11 SMART
Meta Mutation Damage Score 0.3148 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has sequence similarity to yeast longevity assurance gene 1. Mutation or overexpression of the related gene in yeast has been shown to alter yeast lifespan. The human protein may play a role in the regulation of cell growth. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal ceramide species and myelin sheath defects and develop hepatocellular carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rgs3 T C 4: 62,602,977 probably benign Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Cers2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Cers2 APN 3 95321900 missense probably damaging 1.00
IGL00328:Cers2 APN 3 95320686 missense probably benign 0.37
IGL01561:Cers2 APN 3 95322161 splice site probably null
IGL02993:Cers2 APN 3 95320085 missense probably benign 0.00
IGL03115:Cers2 APN 3 95321352 missense probably damaging 1.00
IGL03232:Cers2 APN 3 95320157 missense probably damaging 0.97
R0118:Cers2 UTSW 3 95320226 missense probably benign 0.00
R2849:Cers2 UTSW 3 95322459 missense probably benign 0.42
R4709:Cers2 UTSW 3 95320223 missense possibly damaging 0.82
R5320:Cers2 UTSW 3 95320994 missense probably null 0.99
R5662:Cers2 UTSW 3 95320984 missense probably damaging 1.00
R5821:Cers2 UTSW 3 95321697 intron probably benign
R6808:Cers2 UTSW 3 95321009 missense probably benign 0.27
R7049:Cers2 UTSW 3 95321654 missense probably damaging 1.00
R7117:Cers2 UTSW 3 95320761 critical splice donor site probably null
R7388:Cers2 UTSW 3 95321345 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGGCCCACAAGTTCATAACTG -3'
(R):5'- AGGGAAGCTTGGCTAGTTTC -3'

Sequencing Primer
(F):5'- CCCACAAGTTCATAACTGGAAAGGTG -3'
(R):5'- CTTGGCCTCATGCATTGATG -3'
Posted On2020-01-23