Incidental Mutation 'R8065:Zfp286'
ID 619955
Institutional Source Beutler Lab
Gene Symbol Zfp286
Ensembl Gene ENSMUSG00000047342
Gene Name zinc finger protein 286
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8065 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 62752577-62789462 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62753519 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 192 (I192K)
Ref Sequence ENSEMBL: ENSMUSP00000147022 (fasta)
AlphaFold Q8C0E6
Predicted Effect probably benign
Transcript: ENSMUST00000178750
Predicted Effect unknown
Transcript: ENSMUST00000207597
AA Change: I192K
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cap2 T C 13: 46,637,861 V280A probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Chodl A T 16: 78,946,713 L229F probably damaging Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Diaph3 A T 14: 87,037,495 L175Q probably damaging Het
Dlat A T 9: 50,657,849 M218K possibly damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Ebf1 G A 11: 44,620,547 V90M probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Fbxl16 G A 17: 25,817,983 V313I probably damaging Het
Flrt2 A G 12: 95,780,774 T629A probably benign Het
Gpr87 T A 3: 59,179,887 I66F probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hsd17b4 A T 18: 50,170,752 I431F possibly damaging Het
Iba57 T C 11: 59,163,260 probably benign Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Ldlr T A 9: 21,737,945 C339S probably damaging Het
Myh2 G A 11: 67,181,344 E633K probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
Myo15b G A 11: 115,887,943 probably null Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Naip2 A T 13: 100,189,222 S59R probably damaging Het
Ndc1 T A 4: 107,390,398 S468T probably benign Het
Ndst3 T C 3: 123,601,445 N512S probably damaging Het
Olfr1138 T A 2: 87,737,803 I174F probably damaging Het
Olfr65 A G 7: 103,906,403 probably benign Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Pskh1 T G 8: 105,929,855 S388A possibly damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Slc17a3 A G 13: 23,858,087 R491G unknown Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Ssh2 A G 11: 77,441,985 R431G probably damaging Het
Timm22 G A 11: 76,414,105 D190N probably damaging Het
Ube2g1 G A 11: 72,677,765 G103D probably benign Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp105 A G 9: 122,925,129 T8A probably benign Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Zfp286
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02659:Zfp286 APN 11 62783737 missense possibly damaging 0.54
IGL02745:Zfp286 APN 11 62780874 missense probably damaging 1.00
IGL02826:Zfp286 APN 11 62787960 missense probably damaging 0.99
R0233:Zfp286 UTSW 11 62780393 missense possibly damaging 0.75
R0233:Zfp286 UTSW 11 62780393 missense possibly damaging 0.75
R0318:Zfp286 UTSW 11 62784962 missense probably damaging 1.00
R1954:Zfp286 UTSW 11 62783708 missense possibly damaging 0.46
R1994:Zfp286 UTSW 11 62779820 missense probably damaging 1.00
R2186:Zfp286 UTSW 11 62780461 missense probably damaging 0.97
R4258:Zfp286 UTSW 11 62781070 missense probably benign 0.07
R4327:Zfp286 UTSW 11 62780018 missense probably damaging 1.00
R4453:Zfp286 UTSW 11 62780204 missense probably damaging 1.00
R4479:Zfp286 UTSW 11 62780204 missense probably damaging 1.00
R4647:Zfp286 UTSW 11 62783733 nonsense probably null
R4667:Zfp286 UTSW 11 62780602 missense probably benign 0.00
R4883:Zfp286 UTSW 11 62780629 missense probably benign 0.01
R4978:Zfp286 UTSW 11 62788928 critical splice donor site probably null
R5120:Zfp286 UTSW 11 62780725 missense probably benign 0.40
R5533:Zfp286 UTSW 11 62780970 intron probably benign
R7236:Zfp286 UTSW 11 62783670 critical splice donor site probably null
R7464:Zfp286 UTSW 11 62780801 missense probably benign 0.00
R8067:Zfp286 UTSW 11 62753519 missense unknown
R8716:Zfp286 UTSW 11 62780991 missense unknown
R9351:Zfp286 UTSW 11 62779975 missense probably damaging 0.97
Z1186:Zfp286 UTSW 11 62784956 missense probably damaging 1.00
Z1186:Zfp286 UTSW 11 62787969 missense probably benign
Z1187:Zfp286 UTSW 11 62784956 missense probably damaging 1.00
Z1187:Zfp286 UTSW 11 62787969 missense probably benign
Z1188:Zfp286 UTSW 11 62784956 missense probably damaging 1.00
Z1188:Zfp286 UTSW 11 62787969 missense probably benign
Z1189:Zfp286 UTSW 11 62784956 missense probably damaging 1.00
Z1189:Zfp286 UTSW 11 62787969 missense probably benign
Z1190:Zfp286 UTSW 11 62784956 missense probably damaging 1.00
Z1190:Zfp286 UTSW 11 62787969 missense probably benign
Z1191:Zfp286 UTSW 11 62784956 missense probably damaging 1.00
Z1191:Zfp286 UTSW 11 62787969 missense probably benign
Z1192:Zfp286 UTSW 11 62784956 missense probably damaging 1.00
Z1192:Zfp286 UTSW 11 62787969 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAAATGGGTATCTGCAATCAAATG -3'
(R):5'- CCCCAGGTTAGGACATAAAAGC -3'

Sequencing Primer
(F):5'- GTAAATTCTTCGTGGAGATTCCC -3'
(R):5'- CCAGGTTAGGACATAAAAGCAAGTTG -3'
Posted On 2020-01-23