Mutagenetix > Incidental Mutation

Incidental Mutation 'R8065:Pum1'

619940

Institutional Source

Beutler Lab

Gene Symbol

Pum1

Ensembl Gene

ENSMUSG00000028580

Gene Name

pumilio RNA-binding family member 1

Synonyms

Pumm

MMRRC Submission

067501-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.869) question?

Stock #

R8065 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130663321-130781564 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130751525 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 486 (V486A)

Ref Sequence

ENSEMBL: ENSMUSP00000101613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030315] [ENSMUST00000097862] [ENSMUST00000097864] [ENSMUST00000105991] [ENSMUST00000105992] [ENSMUST00000143277]

AlphaFold

Q80U78

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030315
AA Change: V583A

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000030315
Gene: ENSMUSG00000028580
AA Change: V583A

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
low complexity region	94	102	N/A	INTRINSIC
low complexity region	393	414	N/A	INTRINSIC
low complexity region	443	458	N/A	INTRINSIC
low complexity region	476	503	N/A	INTRINSIC
low complexity region	528	539	N/A	INTRINSIC
low complexity region	584	615	N/A	INTRINSIC
low complexity region	627	637	N/A	INTRINSIC
low complexity region	643	666	N/A	INTRINSIC
low complexity region	672	696	N/A	INTRINSIC
low complexity region	731	741	N/A	INTRINSIC
low complexity region	763	783	N/A	INTRINSIC
low complexity region	798	816	N/A	INTRINSIC
Pumilio	849	884	1.75e-6	SMART
Pumilio	885	920	4.03e-6	SMART
Pumilio	921	955	5.24e-5	SMART
Pumilio	959	994	3.37e-8	SMART
Pumilio	995	1030	6.29e-8	SMART
Pumilio	1031	1066	1.04e-8	SMART
Pumilio	1067	1102	6.2e-7	SMART
Pumilio	1110	1145	8.77e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083262

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097862
AA Change: V582A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000095474
Gene: ENSMUSG00000028580
AA Change: V582A

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
low complexity region	94	102	N/A	INTRINSIC
low complexity region	393	414	N/A	INTRINSIC
low complexity region	442	457	N/A	INTRINSIC
low complexity region	475	502	N/A	INTRINSIC
low complexity region	527	538	N/A	INTRINSIC
low complexity region	583	614	N/A	INTRINSIC
low complexity region	626	636	N/A	INTRINSIC
low complexity region	642	665	N/A	INTRINSIC
low complexity region	671	695	N/A	INTRINSIC
low complexity region	730	740	N/A	INTRINSIC
low complexity region	762	782	N/A	INTRINSIC
low complexity region	797	815	N/A	INTRINSIC
Pumilio	848	883	1.75e-6	SMART
Pumilio	884	919	4.03e-6	SMART
Pumilio	920	954	5.24e-5	SMART
Pumilio	958	993	3.37e-8	SMART
Pumilio	994	1029	6.29e-8	SMART
Pumilio	1030	1065	1.04e-8	SMART
Pumilio	1066	1101	6.2e-7	SMART
Pumilio	1109	1144	8.77e-7	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097864
AA Change: V582A

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000095476
Gene: ENSMUSG00000028580
AA Change: V582A

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
low complexity region	94	102	N/A	INTRINSIC
low complexity region	393	414	N/A	INTRINSIC
low complexity region	442	457	N/A	INTRINSIC
low complexity region	475	502	N/A	INTRINSIC
low complexity region	527	538	N/A	INTRINSIC
low complexity region	583	614	N/A	INTRINSIC
low complexity region	626	636	N/A	INTRINSIC
low complexity region	642	665	N/A	INTRINSIC
low complexity region	671	695	N/A	INTRINSIC
low complexity region	730	740	N/A	INTRINSIC
low complexity region	762	782	N/A	INTRINSIC
low complexity region	797	815	N/A	INTRINSIC
Pumilio	848	883	1.75e-6	SMART
Pumilio	884	919	4.03e-6	SMART
Pumilio	920	955	5.48e-8	SMART
Pumilio	956	991	3.37e-8	SMART
Pumilio	992	1027	6.29e-8	SMART
Pumilio	1028	1063	1.04e-8	SMART
Pumilio	1064	1099	6.2e-7	SMART
Pumilio	1107	1142	8.77e-7	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105991
AA Change: V340A

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101612
Gene: ENSMUSG00000028580
AA Change: V340A

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
low complexity region	94	102	N/A	INTRINSIC
low complexity region	151	172	N/A	INTRINSIC
low complexity region	200	215	N/A	INTRINSIC
low complexity region	233	260	N/A	INTRINSIC
low complexity region	285	296	N/A	INTRINSIC
low complexity region	341	372	N/A	INTRINSIC
low complexity region	384	394	N/A	INTRINSIC
low complexity region	400	423	N/A	INTRINSIC
low complexity region	429	453	N/A	INTRINSIC
low complexity region	488	498	N/A	INTRINSIC
low complexity region	520	540	N/A	INTRINSIC
low complexity region	555	573	N/A	INTRINSIC
Pumilio	606	641	1.75e-6	SMART
Pumilio	642	677	4.03e-6	SMART
Pumilio	678	713	5.48e-8	SMART
Pumilio	714	749	3.37e-8	SMART
Pumilio	750	785	6.29e-8	SMART
Pumilio	786	821	1.04e-8	SMART
Pumilio	822	857	6.2e-7	SMART
Pumilio	865	900	8.77e-7	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105992
AA Change: V486A

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101613
Gene: ENSMUSG00000028580
AA Change: V486A

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
low complexity region	94	102	N/A	INTRINSIC
low complexity region	297	318	N/A	INTRINSIC
low complexity region	346	361	N/A	INTRINSIC
low complexity region	379	406	N/A	INTRINSIC
low complexity region	431	442	N/A	INTRINSIC
low complexity region	487	518	N/A	INTRINSIC
low complexity region	530	540	N/A	INTRINSIC
low complexity region	546	569	N/A	INTRINSIC
low complexity region	575	599	N/A	INTRINSIC
low complexity region	634	644	N/A	INTRINSIC
low complexity region	666	686	N/A	INTRINSIC
low complexity region	701	719	N/A	INTRINSIC
Pumilio	752	787	1.75e-6	SMART
Pumilio	788	823	4.03e-6	SMART
Pumilio	824	858	5.24e-5	SMART
Pumilio	862	897	3.37e-8	SMART
Pumilio	898	933	6.29e-8	SMART
Pumilio	934	969	1.04e-8	SMART
Pumilio	970	1005	6.2e-7	SMART
Pumilio	1013	1048	8.77e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143277

SMART Domains

Protein: ENSMUSP00000114629
Gene: ENSMUSG00000028580

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
low complexity region	94	102	N/A	INTRINSIC
low complexity region	151	172	N/A	INTRINSIC
low complexity region	200	215	N/A	INTRINSIC

Meta Mutation Damage Score

0.1272

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PUF family, evolutionarily conserved RNA-binding proteins related to the Pumilio proteins of Drosophila and the fem-3 mRNA binding factor proteins of C. elegans. The encoded protein contains a sequence-specific RNA binding domain comprised of eight repeats and N- and C-terminal flanking regions, and serves as a translational regulator of specific mRNAs by binding to their 3' untranslated regions. The evolutionarily conserved function of the encoded protein in invertebrates and lower vertebrates suggests that the human protein may be involved in translational regulation of embryogenesis, and cell development and differentiation. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testes weight and size, decreased body weight, oligozoospermia, reduced male fertility, increased male germ cell apoptosis and small seminiferous tubules. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cap2	T	C	13: 46,637,861	V280A	probably damaging	Het
Cbx7	A	T	15: 79,933,898	V1D	unknown	Het
Chodl	A	T	16: 78,946,713	L229F	probably damaging	Het
Depdc5	C	A	5: 32,895,908	N197K	possibly damaging	Het
Diaph3	A	T	14: 87,037,495	L175Q	probably damaging	Het
Dlat	A	T	9: 50,657,849	M218K	possibly damaging	Het
Dnaic1	T	A	4: 41,614,258	D311E	probably damaging	Het
Dpp10	A	G	1: 123,352,660	S646P	probably benign	Het
Ebf1	G	A	11: 44,620,547	V90M	probably benign	Het
Efhd1	C	T	1: 87,264,591	P48S	probably benign	Het
Fbxl16	G	A	17: 25,817,983	V313I	probably damaging	Het
Flrt2	A	G	12: 95,780,774	T629A	probably benign	Het
Gpr87	T	A	3: 59,179,887	I66F	probably damaging	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Hsd17b4	A	T	18: 50,170,752	I431F	possibly damaging	Het
Iba57	T	C	11: 59,163,260		probably benign	Het
Ibtk	A	C	9: 85,720,863	S696R	probably benign	Het
Igkv11-125	C	A	6: 67,913,830	T44N	probably benign	Het
Itih2	T	A	2: 10,123,483	I136F	probably damaging	Het
Itpr3	T	A	17: 27,110,862	D1543E	probably benign	Het
Ldlr	T	A	9: 21,737,945	C339S	probably damaging	Het
Myh2	G	A	11: 67,181,344	E633K	probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Mylk	A	T	16: 34,972,019	E1570V	probably benign	Het
Myo15b	G	A	11: 115,887,943		probably null	Het
N4bp2	T	A	5: 65,807,296	L896H	probably damaging	Het
Naip2	A	T	13: 100,189,222	S59R	probably damaging	Het
Ndc1	T	A	4: 107,390,398	S468T	probably benign	Het
Ndst3	T	C	3: 123,601,445	N512S	probably damaging	Het
Olfr1138	T	A	2: 87,737,803	I174F	probably damaging	Het
Olfr65	A	G	7: 103,906,403		probably benign	Het
Plekhn1	T	C	4: 156,228,240	I54V	possibly damaging	Het
Polr3c	T	C	3: 96,715,652	E350G	probably null	Het
Pskh1	T	G	8: 105,929,855	S388A	possibly damaging	Het
Rin2	T	G	2: 145,861,057	S558A	probably damaging	Het
Ripk4	A	T	16: 97,763,537	V58D	probably damaging	Het
Slc17a3	A	G	13: 23,858,087	R491G	unknown	Het
Smyd3	A	G	1: 179,410,463	M113T	possibly damaging	Het
Ssh2	A	G	11: 77,441,985	R431G	probably damaging	Het
Timm22	G	A	11: 76,414,105	D190N	probably damaging	Het
Ube2g1	G	A	11: 72,677,765	G103D	probably benign	Het
Zbtb5	A	T	4: 44,994,972	S137R	probably benign	Het
Zfp105	A	G	9: 122,925,129	T8A	probably benign	Het
Zfp286	A	T	11: 62,753,519	I192K	unknown	Het
Zfp942	T	C	17: 21,930,410	Y38C	probably damaging	Het
Zfpm1	T	C	8: 122,335,584	S461P	probably benign	Het

Other mutations in Pum1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Pum1	APN	4	130743789	missense	probably damaging	1.00
IGL01327:Pum1	APN	4	130730543	missense	probably damaging	0.97
IGL01360:Pum1	APN	4	130728170	intron	probably benign
IGL02055:Pum1	APN	4	130754054	missense	probably benign	0.19
IGL02713:Pum1	APN	4	130766012	missense	probably damaging	1.00
IGL03401:Pum1	APN	4	130743681	splice site	probably benign
LCD18:Pum1	UTSW	4	130730549	intron	probably benign
R0077:Pum1	UTSW	4	130772674	missense	probably benign	0.06
R0346:Pum1	UTSW	4	130779805	missense	possibly damaging	0.74
R0632:Pum1	UTSW	4	130728104	missense	probably benign	0.34
R0870:Pum1	UTSW	4	130768844	missense	probably damaging	0.99
R1006:Pum1	UTSW	4	130771888	missense	probably damaging	0.98
R1300:Pum1	UTSW	4	130765961	missense	probably damaging	1.00
R1499:Pum1	UTSW	4	130719256	missense	probably damaging	1.00
R1572:Pum1	UTSW	4	130718204	missense	probably damaging	0.99
R1835:Pum1	UTSW	4	130701048	missense	possibly damaging	0.93
R1864:Pum1	UTSW	4	130751525	missense	possibly damaging	0.90
R1991:Pum1	UTSW	4	130718218	missense	possibly damaging	0.93
R2068:Pum1	UTSW	4	130774434	missense	probably benign	0.02
R2119:Pum1	UTSW	4	130669270	missense	possibly damaging	0.92
R2120:Pum1	UTSW	4	130669270	missense	possibly damaging	0.92
R2122:Pum1	UTSW	4	130669270	missense	possibly damaging	0.92
R2153:Pum1	UTSW	4	130751491	missense	probably damaging	1.00
R2164:Pum1	UTSW	4	130728083	nonsense	probably null
R2164:Pum1	UTSW	4	130728084	missense	probably damaging	0.99
R2280:Pum1	UTSW	4	130766011	missense	probably damaging	1.00
R3116:Pum1	UTSW	4	130772660	missense	probably damaging	1.00
R3890:Pum1	UTSW	4	130764082	missense	probably damaging	1.00
R3891:Pum1	UTSW	4	130764082	missense	probably damaging	1.00
R3892:Pum1	UTSW	4	130764082	missense	probably damaging	1.00
R4134:Pum1	UTSW	4	130764069	missense	probably damaging	1.00
R4258:Pum1	UTSW	4	130730280	missense	probably damaging	1.00
R4731:Pum1	UTSW	4	130718193	missense	probably benign	0.00
R4732:Pum1	UTSW	4	130718193	missense	probably benign	0.00
R4733:Pum1	UTSW	4	130718193	missense	probably benign	0.00
R4973:Pum1	UTSW	4	130669137	missense	probably benign	0.27
R5198:Pum1	UTSW	4	130779879	nonsense	probably null
R5249:Pum1	UTSW	4	130762814	missense	probably benign	0.07
R5478:Pum1	UTSW	4	130751484	missense	possibly damaging	0.93
R5652:Pum1	UTSW	4	130764127	missense	possibly damaging	0.95
R5932:Pum1	UTSW	4	130730366	missense	probably benign	0.04
R6008:Pum1	UTSW	4	130768847	missense	probably damaging	1.00
R6112:Pum1	UTSW	4	130730280	missense	probably damaging	1.00
R6416:Pum1	UTSW	4	130728287	splice site	probably null
R6426:Pum1	UTSW	4	130753972	missense	probably damaging	1.00
R6431:Pum1	UTSW	4	130774505	missense	probably damaging	1.00
R7226:Pum1	UTSW	4	130771981	missense	probably damaging	1.00
R7273:Pum1	UTSW	4	130751480	missense	probably damaging	0.99
R7423:Pum1	UTSW	4	130774545	missense	probably damaging	1.00
R7491:Pum1	UTSW	4	130719174	missense	probably benign	0.08
R7526:Pum1	UTSW	4	130747026	missense	probably damaging	0.99
R7731:Pum1	UTSW	4	130762963	missense	probably benign	0.29
R7911:Pum1	UTSW	4	130774477	missense	probably benign	0.40
R8067:Pum1	UTSW	4	130751525	missense	possibly damaging	0.90
R8305:Pum1	UTSW	4	130771920	missense	probably benign	0.02
R8476:Pum1	UTSW	4	130752713	missense	possibly damaging	0.91
R8835:Pum1	UTSW	4	130743753	missense	probably damaging	1.00
R8875:Pum1	UTSW	4	130779875	missense	possibly damaging	0.60
R9003:Pum1	UTSW	4	130747082	missense	probably benign	0.00
R9072:Pum1	UTSW	4	130752861	missense	probably damaging	1.00
R9073:Pum1	UTSW	4	130752861	missense	probably damaging	1.00
R9332:Pum1	UTSW	4	130771898	nonsense	probably null
R9496:Pum1	UTSW	4	130719353	critical splice donor site	probably null
R9801:Pum1	UTSW	4	130754017	missense	probably benign	0.28
X0024:Pum1	UTSW	4	130779790	missense	probably benign	0.00
Z1177:Pum1	UTSW	4	130751479	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGAGGACTTTCCACCTAATACC -3'
(R):5'- AATGCCTTGCAGCTACTGACTC -3'

Sequencing Primer
(F):5'- ACCTAATACCTTGCATGGTGG -3'
(R):5'- TGCAGCTACTGACTCTCTGAAAG -3'

Posted On

2020-01-23