Mutagenetix > Incidental Mutation

Incidental Mutation 'R8079:Per3'

629187

Institutional Source

Beutler Lab

Gene Symbol

Per3

Ensembl Gene

ENSMUSG00000028957

Gene Name

period circadian clock 3

Synonyms

mPer3, 2810049O06Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R8079 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

151003652-151044665 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 151042678 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 129 (T129S)

Ref Sequence

ENSEMBL: ENSMUSP00000099493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030797] [ENSMUST00000103204] [ENSMUST00000136398] [ENSMUST00000169423]

AlphaFold

O70361

PDB Structure

Unwinding the Differences of the Mammalian PERIOD Clock Proteins from Crystal Structure to Cellular Function [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000030797

SMART Domains

Protein: ENSMUSP00000030797
Gene: ENSMUSG00000028955

Domain	Start	End	E-Value	Type
Pfam:Synaptobrevin	15	103	4.2e-37	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103204
AA Change: T129S

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099493
Gene: ENSMUSG00000028957
AA Change: T129S

Domain	Start	End	E-Value	Type
PAS	115	187	2.86e1	SMART
PAS	258	324	1.31e-5	SMART
PAC	333	376	1.52e-1	SMART
low complexity region	414	427	N/A	INTRINSIC
low complexity region	613	627	N/A	INTRINSIC
low complexity region	799	814	N/A	INTRINSIC
low complexity region	845	860	N/A	INTRINSIC
Pfam:Period_C	905	1111	4.4e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136398
AA Change: T129S

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000118950
Gene: ENSMUSG00000028957
AA Change: T129S

Domain	Start	End	E-Value	Type
PAS	115	187	2.86e1	SMART
PAS	258	324	1.31e-5	SMART
PAC	333	376	3.25e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169423

SMART Domains

Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592

Domain	Start	End	E-Value	Type
CG-1	67	183	1.39e-91	SMART
low complexity region	550	583	N/A	INTRINSIC
low complexity region	677	688	N/A	INTRINSIC
Pfam:TIG	874	954	3.1e-11	PFAM
low complexity region	997	1030	N/A	INTRINSIC
ANK	1066	1095	1.7e2	SMART
ANK	1111	1141	4.73e2	SMART
low complexity region	1301	1319	N/A	INTRINSIC
IQ	1548	1564	2.38e2	SMART
IQ	1578	1600	5.42e0	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.0%
20x: 96.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been linked to sleep disorders. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit a shorter circadian cycle length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	A	G	5: 124,083,123	I255T	possibly damaging	Het
Ablim1	A	T	19: 57,182,224		probably null	Het
Akap10	G	A	11: 61,930,054	P8L	possibly damaging	Het
Ankle2	C	T	5: 110,231,316	A27V	probably damaging	Het
Anxa8	A	G	14: 34,094,812	T246A	probably benign	Het
Arhgap5	A	G	12: 52,567,205	N1460S	probably benign	Het
Arid5b	T	G	10: 68,098,356	D572A	possibly damaging	Het
Atrn	T	A	2: 131,013,641	L1278Q	probably null	Het
AU040320	G	T	4: 126,832,160	K454N	possibly damaging	Het
Baz2b	T	A	2: 59,900,768	R2085W	probably damaging	Het
Bbx	A	T	16: 50,210,458	N649K	probably damaging	Het
BC034090	G	A	1: 155,225,286	P411S	probably damaging	Het
Calcoco2	A	T	11: 96,107,537	F20Y	probably damaging	Het
Carmil2	A	G	8: 105,686,761	R50G	probably damaging	Het
Catspere2	A	G	1: 178,046,959	T131A	probably benign	Het
Cdcp1	C	A	9: 123,173,790	V739L	probably damaging	Het
Chit1	A	G	1: 134,144,027	T92A	possibly damaging	Het
Clstn3	A	G	6: 124,459,804	I185T	probably damaging	Het
Dctpp1	C	A	7: 127,259,389	V61L	probably damaging	Het
Dip2a	T	C	10: 76,287,321	T760A	probably benign	Het
Dock10	C	T	1: 80,578,704	V552I	probably benign	Het
Dpcr1	T	C	17: 35,638,192	T172A	unknown	Het
Dpp8	A	G	9: 65,043,735	E151G	probably damaging	Het
Dvl2	G	C	11: 70,007,518	R367P	possibly damaging	Het
Fem1b	A	T	9: 62,796,361	I539N	probably damaging	Het
Frat2	A	T	19: 41,847,838	L25H	probably damaging	Het
Garnl3	A	T	2: 33,018,499		probably null	Het
Gh	T	C	11: 106,301,427	H47R	possibly damaging	Het
Glmp	T	C	3: 88,325,738	V61A	probably damaging	Het
Gm6614	T	G	6: 141,987,734	M462L	probably benign	Het
Gm9925	T	C	18: 74,065,487	V129A	unknown	Het
H2-M9	T	A	17: 36,642,133	E94V	probably benign	Het
Hira	A	T	16: 18,925,757	Q408L	probably benign	Het
Hook3	A	G	8: 26,088,058		probably null	Het
Ifi206	G	A	1: 173,481,158	P424L		Het
Impdh2	T	C	9: 108,563,325	V270A	probably benign	Het
Klhl14	A	G	18: 21,651,965	I135T	probably benign	Het
Klra10	C	A	6: 130,275,775	V179L	probably benign	Het
Kmt2c	T	C	5: 25,302,732	S3236G	probably damaging	Het
Krt76	G	T	15: 101,888,390	A358D	possibly damaging	Het
Lacc1	C	A	14: 77,029,552	G424C	probably damaging	Het
Limch1	A	G	5: 67,046,753	I878V	possibly damaging	Het
Lipi	C	T	16: 75,565,530		probably null	Het
Lrrc17	C	T	5: 21,561,071	R184W	probably damaging	Het
Mllt10	A	G	2: 18,123,756	N183D	probably damaging	Het
Mterf2	C	T	10: 85,120,163	G199D	probably damaging	Het
Nat8f4	A	T	6: 85,900,994	S182R	probably benign	Het
Ndrg3	C	A	2: 156,937,532	E238*	probably null	Het
Nop14	A	T	5: 34,654,461	L194H	probably damaging	Het
Obscn	T	C	11: 59,081,905	E2105G	possibly damaging	Het
Olfr1009	A	T	2: 85,722,043	T213S	probably benign	Het
Olfr1079	T	A	2: 86,538,381	H176L	possibly damaging	Het
Olfr1457	A	C	19: 13,095,284	Y121*	probably null	Het
Olfr829	A	T	9: 18,857,429	Y259F	possibly damaging	Het
Pbx3	C	T	2: 34,178,228	A320T	probably benign	Het
Pcdhac2	A	T	18: 37,146,144	S726C	probably damaging	Het
Pcdhgb2	A	G	18: 37,690,763	D269G	probably damaging	Het
Pcgf6	A	T	19: 47,045,832	S257T	probably damaging	Het
Pclo	A	T	5: 14,540,458	H924L	unknown	Het
Pi4ka	A	T	16: 17,303,060	M1270K		Het
Plec	G	A	15: 76,179,550	Q2277*	probably null	Het
Pnma1	T	A	12: 84,147,335	K198M	probably damaging	Het
Prc1	T	A	7: 80,304,767	F196L	possibly damaging	Het
Prkcz	T	C	4: 155,357,505	T57A	probably damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Robo4	A	G	9: 37,402,635	M61V	possibly damaging	Het
Rps12	C	T	10: 23,785,677	V79I	probably benign	Het
Rsph3a	A	G	17: 7,979,188	K466E	probably benign	Het
Scly	A	T	1: 91,308,367	I168F	probably damaging	Het
Setd1a	T	A	7: 127,785,053	F359I	unknown	Het
Sh3tc1	A	G	5: 35,706,857	L662P	possibly damaging	Het
Slc12a5	T	C	2: 164,992,452	W798R	probably damaging	Het
Slc16a6	C	T	11: 109,473,455	R13Q	unknown	Het
Smarcad1	A	G	6: 65,052,782	D118G	possibly damaging	Het
Sos2	T	C	12: 69,607,215	T788A	probably damaging	Het
Syvn1	A	G	19: 6,048,366	E75G	probably null	Het
Thpo	T	C	16: 20,726,394	E103G	probably benign	Het
Trav7d-3	A	T	14: 52,744,736	E78V	possibly damaging	Het
Uap1	A	G	1: 170,158,763	S217P	probably damaging	Het
Unc45a	T	G	7: 80,331,562	R497S	probably damaging	Het
Upf1	A	G	8: 70,338,884		probably null	Het
Usp47	A	T	7: 112,046,970	K28M	probably damaging	Het
Wdr72	A	C	9: 74,218,772	T1062P	probably damaging	Het
Wnt7b	A	T	15: 85,537,445	C339S	probably damaging	Het
Zfp954	G	T	7: 7,115,471	T358K	probably benign	Het
Zmynd15	G	T	11: 70,459,452		probably benign	Het

Other mutations in Per3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00925:Per3	APN	4	151013598	missense	probably benign	0.28
IGL02112:Per3	APN	4	151029183	missense	probably benign	0.20
IGL02428:Per3	APN	4	151018217	critical splice donor site	probably null
IGL02812:Per3	APN	4	151024470	missense	probably damaging	0.99
IGL03094:Per3	APN	4	151009298	missense	probably damaging	1.00
R0119:Per3	UTSW	4	151024548	intron	probably benign
R0565:Per3	UTSW	4	151033952	missense	probably damaging	1.00
R0671:Per3	UTSW	4	151028831	missense	probably benign	0.27
R1186:Per3	UTSW	4	151026138	missense	probably damaging	0.99
R1736:Per3	UTSW	4	151009248	critical splice donor site	probably null
R1757:Per3	UTSW	4	151042792	critical splice acceptor site	probably null
R1900:Per3	UTSW	4	151041426	missense	probably damaging	1.00
R1929:Per3	UTSW	4	151018885	missense	probably damaging	1.00
R2044:Per3	UTSW	4	151033938	missense	probably benign	0.01
R2272:Per3	UTSW	4	151018885	missense	probably damaging	1.00
R2415:Per3	UTSW	4	151012690	missense	possibly damaging	0.91
R4771:Per3	UTSW	4	151009259	missense	probably damaging	1.00
R5199:Per3	UTSW	4	151012895	missense	probably benign	0.15
R5298:Per3	UTSW	4	151029209	missense	probably damaging	1.00
R5330:Per3	UTSW	4	151041302	missense	probably damaging	1.00
R5331:Per3	UTSW	4	151041302	missense	probably damaging	1.00
R5920:Per3	UTSW	4	151012450	missense	probably benign	0.05
R5974:Per3	UTSW	4	151042737	missense	possibly damaging	0.83
R6498:Per3	UTSW	4	151029205	missense	probably benign	0.27
R6907:Per3	UTSW	4	151043558	critical splice donor site	probably null
R6915:Per3	UTSW	4	151043649	missense	possibly damaging	0.84
R7269:Per3	UTSW	4	151031936	nonsense	probably null
R7454:Per3	UTSW	4	151012728	missense	probably benign	0.05
R7555:Per3	UTSW	4	151018058	nonsense	probably null
R7771:Per3	UTSW	4	151026200	missense	probably damaging	1.00
R7771:Per3	UTSW	4	151041445	missense	probably damaging	1.00
R8071:Per3	UTSW	4	151028813	missense	probably damaging	1.00
R8099:Per3	UTSW	4	151012557	missense	possibly damaging	0.92
R9153:Per3	UTSW	4	151027339	missense	probably benign	0.18
R9449:Per3	UTSW	4	151010488	missense	probably benign	0.02
R9566:Per3	UTSW	4	151028878	missense
R9585:Per3	UTSW	4	151012681	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TCGCGTCTACCTTCAGACAG -3'
(R):5'- GGGATCGTCATCTAAGGAAATACAC -3'

Sequencing Primer
(F):5'- GCGTCTACCTTCAGACAGGATCTC -3'
(R):5'- CCTTAGCGTGCTGAGAAATGACTTC -3'

Posted On

2020-06-30