Incidental Mutation 'R8079:Ablim1'
ID 629255
Institutional Source Beutler Lab
Gene Symbol Ablim1
Ensembl Gene ENSMUSG00000025085
Gene Name actin-binding LIM protein 1
Synonyms 2210411C18Rik, abLIM-L, abLIM-M, 4833406P10Rik, abLIM-S, 9330196J19Rik, 2610209L21Rik, Limab1
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.444) question?
Stock # R8079 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 57032733-57314919 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 57182224 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000079360] [ENSMUST00000099294] [ENSMUST00000111524] [ENSMUST00000111544] [ENSMUST00000111546] [ENSMUST00000111550] [ENSMUST00000111555] [ENSMUST00000111558] [ENSMUST00000111559]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000079360
SMART Domains Protein: ENSMUSP00000078336
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
Pfam:AbLIM_anchor 393 825 1.9e-139 PFAM
VHP 826 861 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099294
SMART Domains Protein: ENSMUSP00000096897
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 467 491 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
VHP 619 654 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111524
SMART Domains Protein: ENSMUSP00000107149
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 21 72 1.14e-9 SMART
LIM 80 132 1.37e-12 SMART
LIM 148 199 1.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111544
SMART Domains Protein: ENSMUSP00000107169
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
low complexity region 422 427 N/A INTRINSIC
coiled coil region 481 505 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
VHP 633 668 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111546
SMART Domains Protein: ENSMUSP00000107172
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 5.7e-12 SMART
LIM 81 133 6.6e-15 SMART
LIM 149 200 5.4e-20 SMART
LIM 208 260 2.8e-14 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 514 538 N/A INTRINSIC
low complexity region 563 578 N/A INTRINSIC
VHP 666 700 1.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111550
SMART Domains Protein: ENSMUSP00000107175
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 312 321 N/A INTRINSIC
coiled coil region 495 519 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
VHP 647 682 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111555
SMART Domains Protein: ENSMUSP00000107180
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
low complexity region 360 369 N/A INTRINSIC
coiled coil region 590 614 N/A INTRINSIC
low complexity region 639 654 N/A INTRINSIC
VHP 742 777 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111558
SMART Domains Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 325 334 N/A INTRINSIC
low complexity region 498 503 N/A INTRINSIC
coiled coil region 557 581 N/A INTRINSIC
low complexity region 606 621 N/A INTRINSIC
VHP 709 744 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111559
SMART Domains Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 297 306 N/A INTRINSIC
coiled coil region 527 551 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
VHP 679 714 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000133369
SMART Domains Protein: ENSMUSP00000117798
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 45 96 1.14e-9 SMART
LIM 104 156 1.37e-12 SMART
LIM 172 223 1.12e-17 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A G 5: 124,083,123 (GRCm38) I255T possibly damaging Het
Akap10 G A 11: 61,930,054 (GRCm38) P8L possibly damaging Het
Ankle2 C T 5: 110,231,316 (GRCm38) A27V probably damaging Het
Anxa8 A G 14: 34,094,812 (GRCm38) T246A probably benign Het
Arhgap5 A G 12: 52,567,205 (GRCm38) N1460S probably benign Het
Arid5b T G 10: 68,098,356 (GRCm38) D572A possibly damaging Het
Atrn T A 2: 131,013,641 (GRCm38) L1278Q probably null Het
AU040320 G T 4: 126,832,160 (GRCm38) K454N possibly damaging Het
Baz2b T A 2: 59,900,768 (GRCm38) R2085W probably damaging Het
Bbx A T 16: 50,210,458 (GRCm38) N649K probably damaging Het
BC034090 G A 1: 155,225,286 (GRCm38) P411S probably damaging Het
Calcoco2 A T 11: 96,107,537 (GRCm38) F20Y probably damaging Het
Carmil2 A G 8: 105,686,761 (GRCm38) R50G probably damaging Het
Catspere2 A G 1: 178,046,959 (GRCm38) T131A probably benign Het
Cdcp1 C A 9: 123,173,790 (GRCm38) V739L probably damaging Het
Chit1 A G 1: 134,144,027 (GRCm38) T92A possibly damaging Het
Clstn3 A G 6: 124,459,804 (GRCm38) I185T probably damaging Het
Dctpp1 C A 7: 127,259,389 (GRCm38) V61L probably damaging Het
Dip2a T C 10: 76,287,321 (GRCm38) T760A probably benign Het
Dock10 C T 1: 80,578,704 (GRCm38) V552I probably benign Het
Dpp8 A G 9: 65,043,735 (GRCm38) E151G probably damaging Het
Dvl2 G C 11: 70,007,518 (GRCm38) R367P possibly damaging Het
Fem1b A T 9: 62,796,361 (GRCm38) I539N probably damaging Het
Frat2 A T 19: 41,847,838 (GRCm38) L25H probably damaging Het
Garnl3 A T 2: 33,018,499 (GRCm38) probably null Het
Gh T C 11: 106,301,427 (GRCm38) H47R possibly damaging Het
Glmp T C 3: 88,325,738 (GRCm38) V61A probably damaging Het
Gm9925 T C 18: 74,065,487 (GRCm38) V129A unknown Het
H2-M9 T A 17: 36,642,133 (GRCm38) E94V probably benign Het
Hira A T 16: 18,925,757 (GRCm38) Q408L probably benign Het
Hook3 A G 8: 26,088,058 (GRCm38) probably null Het
Ifi206 G A 1: 173,481,158 (GRCm38) P424L Het
Impdh2 T C 9: 108,563,325 (GRCm38) V270A probably benign Het
Klhl14 A G 18: 21,651,965 (GRCm38) I135T probably benign Het
Klra10 C A 6: 130,275,775 (GRCm38) V179L probably benign Het
Kmt2c T C 5: 25,302,732 (GRCm38) S3236G probably damaging Het
Krt76 G T 15: 101,888,390 (GRCm38) A358D possibly damaging Het
Lacc1 C A 14: 77,029,552 (GRCm38) G424C probably damaging Het
Limch1 A G 5: 67,046,753 (GRCm38) I878V possibly damaging Het
Lipi C T 16: 75,565,530 (GRCm38) probably null Het
Lrrc17 C T 5: 21,561,071 (GRCm38) R184W probably damaging Het
Mllt10 A G 2: 18,123,756 (GRCm38) N183D probably damaging Het
Mterf2 C T 10: 85,120,163 (GRCm38) G199D probably damaging Het
Mucl3 T C 17: 35,638,192 (GRCm38) T172A unknown Het
Nat8f4 A T 6: 85,900,994 (GRCm38) S182R probably benign Het
Ndrg3 C A 2: 156,937,532 (GRCm38) E238* probably null Het
Nop14 A T 5: 34,654,461 (GRCm38) L194H probably damaging Het
Obscn T C 11: 59,081,905 (GRCm38) E2105G possibly damaging Het
Or5b104 A C 19: 13,095,284 (GRCm38) Y121* probably null Het
Or5g9 A T 2: 85,722,043 (GRCm38) T213S probably benign Het
Or7g17 A T 9: 18,857,429 (GRCm38) Y259F possibly damaging Het
Or8k32 T A 2: 86,538,381 (GRCm38) H176L possibly damaging Het
Pbx3 C T 2: 34,178,228 (GRCm38) A320T probably benign Het
Pcdhac2 A T 18: 37,146,144 (GRCm38) S726C probably damaging Het
Pcdhgb2 A G 18: 37,690,763 (GRCm38) D269G probably damaging Het
Pcgf6 A T 19: 47,045,832 (GRCm38) S257T probably damaging Het
Pclo A T 5: 14,540,458 (GRCm38) H924L unknown Het
Per3 T A 4: 151,042,678 (GRCm38) T129S possibly damaging Het
Pi4ka A T 16: 17,303,060 (GRCm38) M1270K Het
Plec G A 15: 76,179,550 (GRCm38) Q2277* probably null Het
Pnma1 T A 12: 84,147,335 (GRCm38) K198M probably damaging Het
Prc1 T A 7: 80,304,767 (GRCm38) F196L possibly damaging Het
Prkcz T C 4: 155,357,505 (GRCm38) T57A probably damaging Het
Repin1 G T 6: 48,597,345 (GRCm38) E403* probably null Het
Robo4 A G 9: 37,402,635 (GRCm38) M61V possibly damaging Het
Rps12 C T 10: 23,785,677 (GRCm38) V79I probably benign Het
Rsph3a A G 17: 7,979,188 (GRCm38) K466E probably benign Het
Scly A T 1: 91,308,367 (GRCm38) I168F probably damaging Het
Setd1a T A 7: 127,785,053 (GRCm38) F359I unknown Het
Sh3tc1 A G 5: 35,706,857 (GRCm38) L662P possibly damaging Het
Slc12a5 T C 2: 164,992,452 (GRCm38) W798R probably damaging Het
Slc16a6 C T 11: 109,473,455 (GRCm38) R13Q unknown Het
Slco1a8 T G 6: 141,987,734 (GRCm38) M462L probably benign Het
Smarcad1 A G 6: 65,052,782 (GRCm38) D118G possibly damaging Het
Sos2 T C 12: 69,607,215 (GRCm38) T788A probably damaging Het
Syvn1 A G 19: 6,048,366 (GRCm38) E75G probably null Het
Thpo T C 16: 20,726,394 (GRCm38) E103G probably benign Het
Trav7d-3 A T 14: 52,744,736 (GRCm38) E78V possibly damaging Het
Uap1 A G 1: 170,158,763 (GRCm38) S217P probably damaging Het
Unc45a T G 7: 80,331,562 (GRCm38) R497S probably damaging Het
Upf1 A G 8: 70,338,884 (GRCm38) probably null Het
Usp47 A T 7: 112,046,970 (GRCm38) K28M probably damaging Het
Wdr72 A C 9: 74,218,772 (GRCm38) T1062P probably damaging Het
Wnt7b A T 15: 85,537,445 (GRCm38) C339S probably damaging Het
Zfp954 G T 7: 7,115,471 (GRCm38) T358K probably benign Het
Zmynd15 G T 11: 70,459,452 (GRCm38) probably benign Het
Other mutations in Ablim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ablim1 APN 19 57,068,186 (GRCm38) missense probably damaging 1.00
IGL00466:Ablim1 APN 19 57,068,186 (GRCm38) missense probably damaging 1.00
IGL00478:Ablim1 APN 19 57,068,186 (GRCm38) missense probably damaging 1.00
IGL00847:Ablim1 APN 19 57,152,290 (GRCm38) missense possibly damaging 0.59
IGL01063:Ablim1 APN 19 57,061,328 (GRCm38) missense probably damaging 1.00
IGL01304:Ablim1 APN 19 57,215,721 (GRCm38) missense probably benign
IGL01385:Ablim1 APN 19 57,068,914 (GRCm38) missense probably damaging 1.00
IGL01707:Ablim1 APN 19 57,039,447 (GRCm38) missense probably damaging 1.00
IGL02386:Ablim1 APN 19 57,134,654 (GRCm38) missense probably damaging 1.00
IGL02427:Ablim1 APN 19 57,079,880 (GRCm38) splice site probably benign
IGL02498:Ablim1 APN 19 57,152,319 (GRCm38) nonsense probably null
A9681:Ablim1 UTSW 19 57,173,323 (GRCm38) critical splice donor site probably null
R0089:Ablim1 UTSW 19 57,043,031 (GRCm38) missense probably damaging 1.00
R0226:Ablim1 UTSW 19 57,043,870 (GRCm38) missense probably damaging 1.00
R1419:Ablim1 UTSW 19 57,134,633 (GRCm38) missense probably damaging 1.00
R1473:Ablim1 UTSW 19 57,068,236 (GRCm38) missense probably damaging 1.00
R1587:Ablim1 UTSW 19 57,083,547 (GRCm38) start codon destroyed probably null 0.99
R1588:Ablim1 UTSW 19 57,083,547 (GRCm38) start codon destroyed probably null 0.99
R1935:Ablim1 UTSW 19 57,215,965 (GRCm38) start gained probably null
R1936:Ablim1 UTSW 19 57,215,965 (GRCm38) start gained probably null
R2021:Ablim1 UTSW 19 57,047,018 (GRCm38) missense probably damaging 0.98
R2110:Ablim1 UTSW 19 57,043,813 (GRCm38) missense possibly damaging 0.83
R2270:Ablim1 UTSW 19 57,077,431 (GRCm38) missense possibly damaging 0.58
R2509:Ablim1 UTSW 19 57,152,359 (GRCm38) missense probably damaging 1.00
R3621:Ablim1 UTSW 19 57,152,303 (GRCm38) missense probably damaging 0.97
R3732:Ablim1 UTSW 19 57,049,460 (GRCm38) critical splice donor site probably null
R3732:Ablim1 UTSW 19 57,049,460 (GRCm38) critical splice donor site probably null
R3733:Ablim1 UTSW 19 57,049,460 (GRCm38) critical splice donor site probably null
R3734:Ablim1 UTSW 19 57,049,460 (GRCm38) critical splice donor site probably null
R3878:Ablim1 UTSW 19 57,037,210 (GRCm38) splice site probably null
R4354:Ablim1 UTSW 19 57,155,278 (GRCm38) missense probably damaging 1.00
R4543:Ablim1 UTSW 19 57,077,442 (GRCm38) missense possibly damaging 0.87
R4749:Ablim1 UTSW 19 57,215,721 (GRCm38) missense probably benign
R4860:Ablim1 UTSW 19 57,079,866 (GRCm38) missense probably damaging 1.00
R4860:Ablim1 UTSW 19 57,079,866 (GRCm38) missense probably damaging 1.00
R5072:Ablim1 UTSW 19 57,073,853 (GRCm38) critical splice donor site probably null
R5277:Ablim1 UTSW 19 57,155,261 (GRCm38) missense probably damaging 1.00
R5331:Ablim1 UTSW 19 57,155,249 (GRCm38) missense probably damaging 1.00
R5354:Ablim1 UTSW 19 57,130,923 (GRCm38) missense probably benign 0.07
R5893:Ablim1 UTSW 19 57,215,853 (GRCm38) missense probably benign 0.07
R5958:Ablim1 UTSW 19 57,041,935 (GRCm38) missense probably damaging 1.00
R6435:Ablim1 UTSW 19 57,061,355 (GRCm38) missense possibly damaging 0.69
R6460:Ablim1 UTSW 19 57,079,839 (GRCm38) missense possibly damaging 0.96
R6642:Ablim1 UTSW 19 57,130,852 (GRCm38) missense probably benign 0.03
R6662:Ablim1 UTSW 19 57,073,853 (GRCm38) critical splice donor site probably null
R6705:Ablim1 UTSW 19 57,215,821 (GRCm38) missense probably benign 0.01
R7111:Ablim1 UTSW 19 57,073,877 (GRCm38) missense probably benign 0.05
R7291:Ablim1 UTSW 19 57,215,908 (GRCm38) missense probably benign
R7363:Ablim1 UTSW 19 57,215,741 (GRCm38) missense probably benign 0.10
R7901:Ablim1 UTSW 19 57,131,002 (GRCm38) splice site probably null
R7974:Ablim1 UTSW 19 57,044,973 (GRCm38) critical splice acceptor site probably null
R8087:Ablim1 UTSW 19 57,182,256 (GRCm38) missense
R8120:Ablim1 UTSW 19 57,046,928 (GRCm38) missense probably benign 0.00
R8277:Ablim1 UTSW 19 57,215,919 (GRCm38) missense probably benign 0.10
R8339:Ablim1 UTSW 19 57,043,849 (GRCm38) missense probably benign 0.00
R8536:Ablim1 UTSW 19 57,182,286 (GRCm38) intron probably benign
R8857:Ablim1 UTSW 19 57,130,855 (GRCm38) missense possibly damaging 0.84
R8875:Ablim1 UTSW 19 57,130,954 (GRCm38) missense probably benign 0.00
R8983:Ablim1 UTSW 19 57,239,212 (GRCm38) missense probably benign 0.02
R9055:Ablim1 UTSW 19 57,041,966 (GRCm38) missense probably benign 0.10
R9475:Ablim1 UTSW 19 57,239,180 (GRCm38) missense probably benign 0.00
R9505:Ablim1 UTSW 19 57,197,350 (GRCm38) intron probably benign
R9695:Ablim1 UTSW 19 57,182,307 (GRCm38) missense
R9762:Ablim1 UTSW 19 57,037,259 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTTACTCGGTAGCTTAAAGG -3'
(R):5'- TCATACTGAAAGCCTGATCGGG -3'

Sequencing Primer
(F):5'- ACTCGGTAGCTTAAAGGTTGCTAAG -3'
(R):5'- ATCGGGCTGAACTTCAGGTC -3'
Posted On 2020-06-30