Incidental Mutation 'R8079:Atrn'
ID629182
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Nameattractin
SynonymsMgca
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8079 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130906495-131030333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131013641 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1278 (L1278Q)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
Predicted Effect probably null
Transcript: ENSMUST00000028781
AA Change: L1278Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: L1278Q

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 A G 5: 124,083,123 I255T possibly damaging Het
Ablim1 A T 19: 57,182,224 probably null Het
Akap10 G A 11: 61,930,054 P8L possibly damaging Het
Ankle2 C T 5: 110,231,316 A27V probably damaging Het
Anxa8 A G 14: 34,094,812 T246A probably benign Het
Arhgap5 A G 12: 52,567,205 N1460S probably benign Het
Arid5b T G 10: 68,098,356 D572A possibly damaging Het
AU040320 G T 4: 126,832,160 K454N possibly damaging Het
Baz2b T A 2: 59,900,768 R2085W probably damaging Het
Bbx A T 16: 50,210,458 N649K probably damaging Het
BC034090 G A 1: 155,225,286 P411S probably damaging Het
Calcoco2 A T 11: 96,107,537 F20Y probably damaging Het
Carmil2 A G 8: 105,686,761 R50G probably damaging Het
Catspere2 A G 1: 178,046,959 T131A probably benign Het
Cdcp1 C A 9: 123,173,790 V739L probably damaging Het
Chit1 A G 1: 134,144,027 T92A possibly damaging Het
Clstn3 A G 6: 124,459,804 I185T probably damaging Het
Dctpp1 C A 7: 127,259,389 V61L probably damaging Het
Dip2a T C 10: 76,287,321 T760A probably benign Het
Dock10 C T 1: 80,578,704 V552I probably benign Het
Dpcr1 T C 17: 35,638,192 T172A unknown Het
Dpp8 A G 9: 65,043,735 E151G probably damaging Het
Dvl2 G C 11: 70,007,518 R367P possibly damaging Het
Fem1b A T 9: 62,796,361 I539N probably damaging Het
Frat2 A T 19: 41,847,838 L25H probably damaging Het
Garnl3 A T 2: 33,018,499 probably null Het
Gh T C 11: 106,301,427 H47R possibly damaging Het
Glmp T C 3: 88,325,738 V61A probably damaging Het
Gm6614 T G 6: 141,987,734 M462L probably benign Het
Gm9925 T C 18: 74,065,487 V129A unknown Het
H2-M9 T A 17: 36,642,133 E94V probably benign Het
Hira A T 16: 18,925,757 Q408L probably benign Het
Hook3 A G 8: 26,088,058 probably null Het
Ifi206 G A 1: 173,481,158 P424L Het
Impdh2 T C 9: 108,563,325 V270A probably benign Het
Klhl14 A G 18: 21,651,965 I135T probably benign Het
Klra10 C A 6: 130,275,775 V179L probably benign Het
Kmt2c T C 5: 25,302,732 S3236G probably damaging Het
Krt76 G T 15: 101,888,390 A358D possibly damaging Het
Lacc1 C A 14: 77,029,552 G424C probably damaging Het
Limch1 A G 5: 67,046,753 I878V possibly damaging Het
Lipi C T 16: 75,565,530 probably null Het
Lrrc17 C T 5: 21,561,071 R184W probably damaging Het
Mllt10 A G 2: 18,123,756 N183D probably damaging Het
Mterf2 C T 10: 85,120,163 G199D probably damaging Het
Nat8f4 A T 6: 85,900,994 S182R probably benign Het
Ndrg3 C A 2: 156,937,532 E238* probably null Het
Nop14 A T 5: 34,654,461 L194H probably damaging Het
Obscn T C 11: 59,081,905 E2105G possibly damaging Het
Olfr1009 A T 2: 85,722,043 T213S probably benign Het
Olfr1079 T A 2: 86,538,381 H176L possibly damaging Het
Olfr1457 A C 19: 13,095,284 Y121* probably null Het
Olfr829 A T 9: 18,857,429 Y259F possibly damaging Het
Pbx3 C T 2: 34,178,228 A320T probably benign Het
Pcdhac2 A T 18: 37,146,144 S726C probably damaging Het
Pcdhgb2 A G 18: 37,690,763 D269G probably damaging Het
Pcgf6 A T 19: 47,045,832 S257T probably damaging Het
Pclo A T 5: 14,540,458 H924L unknown Het
Per3 T A 4: 151,042,678 T129S possibly damaging Het
Pi4ka A T 16: 17,303,060 M1270K Het
Plec G A 15: 76,179,550 Q2277* probably null Het
Pnma1 T A 12: 84,147,335 K198M probably damaging Het
Prc1 T A 7: 80,304,767 F196L possibly damaging Het
Prkcz T C 4: 155,357,505 T57A probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Robo4 A G 9: 37,402,635 M61V possibly damaging Het
Rps12 C T 10: 23,785,677 V79I probably benign Het
Rsph3a A G 17: 7,979,188 K466E probably benign Het
Scly A T 1: 91,308,367 I168F probably damaging Het
Setd1a T A 7: 127,785,053 F359I unknown Het
Sh3tc1 A G 5: 35,706,857 L662P possibly damaging Het
Slc12a5 T C 2: 164,992,452 W798R probably damaging Het
Slc16a6 C T 11: 109,473,455 R13Q unknown Het
Smarcad1 A G 6: 65,052,782 D118G possibly damaging Het
Sos2 T C 12: 69,607,215 T788A probably damaging Het
Syvn1 A G 19: 6,048,366 E75G probably null Het
Thpo T C 16: 20,726,394 E103G probably benign Het
Trav7d-3 A T 14: 52,744,736 E78V possibly damaging Het
Uap1 A G 1: 170,158,763 S217P probably damaging Het
Unc45a T G 7: 80,331,562 R497S probably damaging Het
Upf1 A G 8: 70,338,884 probably null Het
Usp47 A T 7: 112,046,970 K28M probably damaging Het
Wdr72 A C 9: 74,218,772 T1062P probably damaging Het
Wnt7b A T 15: 85,537,445 C339S probably damaging Het
Zfp954 G T 7: 7,115,471 T358K probably benign Het
Zmynd15 G T 11: 70,459,452 probably benign Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130958079 missense probably damaging 1.00
IGL00571:Atrn APN 2 130995048 missense probably damaging 1.00
IGL01092:Atrn APN 2 130947636 nonsense probably null
IGL01572:Atrn APN 2 131002795 missense probably damaging 1.00
IGL01924:Atrn APN 2 130935565 missense probably damaging 1.00
IGL02116:Atrn APN 2 130958089 missense probably damaging 1.00
IGL02372:Atrn APN 2 131002754 splice site probably benign
IGL02390:Atrn APN 2 131020977 missense possibly damaging 0.82
IGL02548:Atrn APN 2 130972282 missense probably damaging 1.00
IGL02749:Atrn APN 2 130970144 nonsense probably null
IGL02749:Atrn APN 2 130947734 splice site probably benign
BB010:Atrn UTSW 2 130995066 missense probably damaging 1.00
BB020:Atrn UTSW 2 130995066 missense probably damaging 1.00
R0026:Atrn UTSW 2 130957920 missense probably damaging 1.00
R0403:Atrn UTSW 2 130906859 missense probably damaging 1.00
R0479:Atrn UTSW 2 130999165 nonsense probably null
R0544:Atrn UTSW 2 130986826 missense probably damaging 1.00
R0570:Atrn UTSW 2 130980134 missense probably benign 0.01
R0606:Atrn UTSW 2 130906856 missense possibly damaging 0.90
R0617:Atrn UTSW 2 130995085 critical splice donor site probably null
R0658:Atrn UTSW 2 130970227 critical splice donor site probably null
R1108:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1112:Atrn UTSW 2 130999161 missense probably benign 0.04
R1219:Atrn UTSW 2 131021007 missense possibly damaging 0.90
R1422:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1524:Atrn UTSW 2 130957080 missense probably benign 0.15
R1653:Atrn UTSW 2 130935624 missense probably benign
R1795:Atrn UTSW 2 130972288 missense probably benign
R1807:Atrn UTSW 2 130982772 missense possibly damaging 0.94
R1920:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1921:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1935:Atrn UTSW 2 130958035 missense probably damaging 1.00
R1982:Atrn UTSW 2 130970222 missense probably benign
R2000:Atrn UTSW 2 130935588 missense probably damaging 1.00
R2143:Atrn UTSW 2 130957996 missense probably benign 0.03
R2336:Atrn UTSW 2 130957954 missense probably damaging 1.00
R2679:Atrn UTSW 2 130961675 critical splice donor site probably null
R3426:Atrn UTSW 2 131020956 missense probably benign 0.06
R3909:Atrn UTSW 2 130994207 missense probably damaging 1.00
R4077:Atrn UTSW 2 130964930 critical splice donor site probably null
R4162:Atrn UTSW 2 130994228 splice site probably benign
R4195:Atrn UTSW 2 130933412 missense probably damaging 1.00
R4364:Atrn UTSW 2 130970208 missense probably benign 0.39
R4465:Atrn UTSW 2 130960468 missense probably benign 0.08
R4510:Atrn UTSW 2 130935577 nonsense probably null
R4511:Atrn UTSW 2 130935577 nonsense probably null
R4527:Atrn UTSW 2 130973504 missense probably benign 0.10
R4586:Atrn UTSW 2 130982042 missense probably damaging 1.00
R4592:Atrn UTSW 2 130999130 intron probably benign
R4658:Atrn UTSW 2 130933429 missense probably damaging 1.00
R4735:Atrn UTSW 2 131020990 missense probably benign 0.06
R4960:Atrn UTSW 2 130995047 nonsense probably null
R4999:Atrn UTSW 2 130975954 missense probably damaging 1.00
R5066:Atrn UTSW 2 130994193 missense possibly damaging 0.60
R5080:Atrn UTSW 2 130970124 missense possibly damaging 0.95
R5141:Atrn UTSW 2 130999130 intron probably benign
R5256:Atrn UTSW 2 130946019 missense probably benign 0.39
R5494:Atrn UTSW 2 131023075 missense probably damaging 1.00
R5678:Atrn UTSW 2 130970016 missense probably damaging 0.96
R5752:Atrn UTSW 2 130906544 unclassified probably benign
R5931:Atrn UTSW 2 130933436 missense possibly damaging 0.56
R6023:Atrn UTSW 2 131020980 missense probably benign 0.25
R6176:Atrn UTSW 2 130946091 missense probably benign 0.31
R6377:Atrn UTSW 2 130979969 missense probably damaging 1.00
R6433:Atrn UTSW 2 131023027 missense probably damaging 1.00
R7226:Atrn UTSW 2 130986744 missense probably damaging 0.99
R7402:Atrn UTSW 2 130947600 missense probably damaging 1.00
R7541:Atrn UTSW 2 130961571 missense possibly damaging 0.46
R7587:Atrn UTSW 2 130980114 missense probably damaging 1.00
R7872:Atrn UTSW 2 130970227 critical splice donor site probably null
R7910:Atrn UTSW 2 130964887 missense probably benign 0.04
R7913:Atrn UTSW 2 130970211 missense probably damaging 1.00
R7933:Atrn UTSW 2 130995066 missense probably damaging 1.00
R8044:Atrn UTSW 2 130935529 missense probably damaging 1.00
R8093:Atrn UTSW 2 130975988 missense probably benign 0.00
R8203:Atrn UTSW 2 130960549 missense probably benign 0.00
R8234:Atrn UTSW 2 131023000 critical splice acceptor site probably null
R8462:Atrn UTSW 2 130935584 missense probably damaging 1.00
R8816:Atrn UTSW 2 130906878 missense probably damaging 1.00
R8816:Atrn UTSW 2 131004574 missense probably damaging 1.00
R8831:Atrn UTSW 2 130906601 missense probably benign 0.22
R8937:Atrn UTSW 2 130999237 missense probably benign 0.00
RF009:Atrn UTSW 2 130906922 missense probably benign 0.12
X0024:Atrn UTSW 2 130958139 missense probably damaging 1.00
Z1088:Atrn UTSW 2 130973399 missense probably benign
Z1176:Atrn UTSW 2 130946193 missense probably benign 0.27
Z1177:Atrn UTSW 2 130946042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACGGTCAATTCTGAGACAC -3'
(R):5'- TGCTTGAGCCCAAACCTCTC -3'

Sequencing Primer
(F):5'- CGGTCAATTCTGAGACACACAGTAG -3'
(R):5'- TCTCCCCATGCAAAGAGCCG -3'
Posted On2020-06-30