Mutagenetix > Incidental Mutation

Incidental Mutation 'R8079:Atrn'

629182

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8079 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 131013641 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1278 (L1278Q)

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

probably null
Transcript: ENSMUST00000028781
AA Change: L1278Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: L1278Q

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.0%
20x: 96.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	A	G	5: 124,083,123	I255T	possibly damaging	Het
Ablim1	A	T	19: 57,182,224		probably null	Het
Akap10	G	A	11: 61,930,054	P8L	possibly damaging	Het
Ankle2	C	T	5: 110,231,316	A27V	probably damaging	Het
Anxa8	A	G	14: 34,094,812	T246A	probably benign	Het
Arhgap5	A	G	12: 52,567,205	N1460S	probably benign	Het
Arid5b	T	G	10: 68,098,356	D572A	possibly damaging	Het
AU040320	G	T	4: 126,832,160	K454N	possibly damaging	Het
Baz2b	T	A	2: 59,900,768	R2085W	probably damaging	Het
Bbx	A	T	16: 50,210,458	N649K	probably damaging	Het
BC034090	G	A	1: 155,225,286	P411S	probably damaging	Het
Calcoco2	A	T	11: 96,107,537	F20Y	probably damaging	Het
Carmil2	A	G	8: 105,686,761	R50G	probably damaging	Het
Catspere2	A	G	1: 178,046,959	T131A	probably benign	Het
Cdcp1	C	A	9: 123,173,790	V739L	probably damaging	Het
Chit1	A	G	1: 134,144,027	T92A	possibly damaging	Het
Clstn3	A	G	6: 124,459,804	I185T	probably damaging	Het
Dctpp1	C	A	7: 127,259,389	V61L	probably damaging	Het
Dip2a	T	C	10: 76,287,321	T760A	probably benign	Het
Dock10	C	T	1: 80,578,704	V552I	probably benign	Het
Dpcr1	T	C	17: 35,638,192	T172A	unknown	Het
Dpp8	A	G	9: 65,043,735	E151G	probably damaging	Het
Dvl2	G	C	11: 70,007,518	R367P	possibly damaging	Het
Fem1b	A	T	9: 62,796,361	I539N	probably damaging	Het
Frat2	A	T	19: 41,847,838	L25H	probably damaging	Het
Garnl3	A	T	2: 33,018,499		probably null	Het
Gh	T	C	11: 106,301,427	H47R	possibly damaging	Het
Glmp	T	C	3: 88,325,738	V61A	probably damaging	Het
Gm6614	T	G	6: 141,987,734	M462L	probably benign	Het
Gm9925	T	C	18: 74,065,487	V129A	unknown	Het
H2-M9	T	A	17: 36,642,133	E94V	probably benign	Het
Hira	A	T	16: 18,925,757	Q408L	probably benign	Het
Hook3	A	G	8: 26,088,058		probably null	Het
Ifi206	G	A	1: 173,481,158	P424L		Het
Impdh2	T	C	9: 108,563,325	V270A	probably benign	Het
Klhl14	A	G	18: 21,651,965	I135T	probably benign	Het
Klra10	C	A	6: 130,275,775	V179L	probably benign	Het
Kmt2c	T	C	5: 25,302,732	S3236G	probably damaging	Het
Krt76	G	T	15: 101,888,390	A358D	possibly damaging	Het
Lacc1	C	A	14: 77,029,552	G424C	probably damaging	Het
Limch1	A	G	5: 67,046,753	I878V	possibly damaging	Het
Lipi	C	T	16: 75,565,530		probably null	Het
Lrrc17	C	T	5: 21,561,071	R184W	probably damaging	Het
Mllt10	A	G	2: 18,123,756	N183D	probably damaging	Het
Mterf2	C	T	10: 85,120,163	G199D	probably damaging	Het
Nat8f4	A	T	6: 85,900,994	S182R	probably benign	Het
Ndrg3	C	A	2: 156,937,532	E238*	probably null	Het
Nop14	A	T	5: 34,654,461	L194H	probably damaging	Het
Obscn	T	C	11: 59,081,905	E2105G	possibly damaging	Het
Olfr1009	A	T	2: 85,722,043	T213S	probably benign	Het
Olfr1079	T	A	2: 86,538,381	H176L	possibly damaging	Het
Olfr1457	A	C	19: 13,095,284	Y121*	probably null	Het
Olfr829	A	T	9: 18,857,429	Y259F	possibly damaging	Het
Pbx3	C	T	2: 34,178,228	A320T	probably benign	Het
Pcdhac2	A	T	18: 37,146,144	S726C	probably damaging	Het
Pcdhgb2	A	G	18: 37,690,763	D269G	probably damaging	Het
Pcgf6	A	T	19: 47,045,832	S257T	probably damaging	Het
Pclo	A	T	5: 14,540,458	H924L	unknown	Het
Per3	T	A	4: 151,042,678	T129S	possibly damaging	Het
Pi4ka	A	T	16: 17,303,060	M1270K		Het
Plec	G	A	15: 76,179,550	Q2277*	probably null	Het
Pnma1	T	A	12: 84,147,335	K198M	probably damaging	Het
Prc1	T	A	7: 80,304,767	F196L	possibly damaging	Het
Prkcz	T	C	4: 155,357,505	T57A	probably damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Robo4	A	G	9: 37,402,635	M61V	possibly damaging	Het
Rps12	C	T	10: 23,785,677	V79I	probably benign	Het
Rsph3a	A	G	17: 7,979,188	K466E	probably benign	Het
Scly	A	T	1: 91,308,367	I168F	probably damaging	Het
Setd1a	T	A	7: 127,785,053	F359I	unknown	Het
Sh3tc1	A	G	5: 35,706,857	L662P	possibly damaging	Het
Slc12a5	T	C	2: 164,992,452	W798R	probably damaging	Het
Slc16a6	C	T	11: 109,473,455	R13Q	unknown	Het
Smarcad1	A	G	6: 65,052,782	D118G	possibly damaging	Het
Sos2	T	C	12: 69,607,215	T788A	probably damaging	Het
Syvn1	A	G	19: 6,048,366	E75G	probably null	Het
Thpo	T	C	16: 20,726,394	E103G	probably benign	Het
Trav7d-3	A	T	14: 52,744,736	E78V	possibly damaging	Het
Uap1	A	G	1: 170,158,763	S217P	probably damaging	Het
Unc45a	T	G	7: 80,331,562	R497S	probably damaging	Het
Upf1	A	G	8: 70,338,884		probably null	Het
Usp47	A	T	7: 112,046,970	K28M	probably damaging	Het
Wdr72	A	C	9: 74,218,772	T1062P	probably damaging	Het
Wnt7b	A	T	15: 85,537,445	C339S	probably damaging	Het
Zfp954	G	T	7: 7,115,471	T358K	probably benign	Het
Zmynd15	G	T	11: 70,459,452		probably benign	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGACGGTCAATTCTGAGACAC -3'
(R):5'- TGCTTGAGCCCAAACCTCTC -3'

Sequencing Primer
(F):5'- CGGTCAATTCTGAGACACACAGTAG -3'
(R):5'- TCTCCCCATGCAAAGAGCCG -3'

Posted On

2020-06-30