Incidental Mutation 'R8099:Sltm'
ID630407
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene NameSAFB-like, transcription modulator
Synonyms9130215G10Rik, 5730555F13Rik, 5730455C01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R8099 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location70542754-70592234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70586078 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 786 (S786T)
Ref Sequence ENSEMBL: ENSMUSP00000049112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000216816] [ENSMUST00000217593]
Predicted Effect probably damaging
Transcript: ENSMUST00000049263
AA Change: S786T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: S786T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216816
AA Change: S768T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000217593
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T C 14: 70,157,520 R62G probably benign Het
Abcb9 A G 5: 124,077,245 F478L probably benign Het
Abcc9 A T 6: 142,675,531 N494K probably damaging Het
Atp11a T G 8: 12,861,973 M124R Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc110 T A 8: 45,942,093 H340Q probably damaging Het
Celsr1 A G 15: 86,031,600 L724P probably damaging Het
Cfap74 A G 4: 155,455,032 N938S unknown Het
Chil3 T G 3: 106,148,668 D363A probably damaging Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Cpne3 A G 4: 19,525,169 V442A possibly damaging Het
Ctsh T C 9: 90,064,247 V130A probably damaging Het
Cyp3a44 T C 5: 145,788,402 K330E probably benign Het
Dgcr2 A T 16: 17,849,769 D275E probably damaging Het
Dnah1 A T 14: 31,302,364 D919E probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Epb41l3 T A 17: 69,247,688 F261Y possibly damaging Het
Fam189b T C 3: 89,183,943 F74L probably damaging Het
Fbxo3 A C 2: 104,054,935 H383P probably damaging Het
Foxp1 C T 6: 98,945,549 V441M unknown Het
Gm29106 C T 1: 118,198,791 S71F probably benign Het
Golga3 T A 5: 110,188,707 L364* probably null Het
Herc1 T A 9: 66,372,140 L110H probably damaging Het
Hist1h1a C T 13: 23,763,849 L45F probably damaging Het
Igkv4-53 A T 6: 69,648,914 S90T possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kti12 G T 4: 108,848,374 G162W probably damaging Het
Lama3 T A 18: 12,534,063 I763N probably damaging Het
Macf1 A T 4: 123,476,129 I1613K probably benign Het
Mkrn1 T C 6: 39,410,097 D102G probably benign Het
Muc2 T A 7: 141,745,438 probably null Het
Nipal4 T C 11: 46,162,021 E39G probably benign Het
Nr1h2 T C 7: 44,550,322 Y391C possibly damaging Het
Odam T C 5: 87,892,440 I255T possibly damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr279 A G 15: 98,497,813 M114V probably benign Het
Olfr781 T A 10: 129,333,127 I82K probably damaging Het
Per3 A T 4: 151,012,557 M837K possibly damaging Het
Pitpnm3 T A 11: 72,070,318 H357L possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb1 T C 2: 135,251,734 Y156H possibly damaging Het
Ppm1d C T 11: 85,339,666 P370L possibly damaging Het
Prrc2b T C 2: 32,208,674 V666A probably benign Het
Ptpn3 A T 4: 57,204,985 C725* probably null Het
Rapgefl1 T C 11: 98,847,383 W437R probably damaging Het
Sema4g T C 19: 44,992,528 L5P probably damaging Het
Sipa1l1 C T 12: 82,433,826 P1529L probably benign Het
Slc12a2 T C 18: 57,899,392 L388P probably damaging Het
Srsf1 T C 11: 88,049,256 I198T probably benign Het
Ssh2 C T 11: 77,454,929 R1247* probably null Het
Ssu2 T C 6: 112,376,477 T229A probably benign Het
Stra6 T A 9: 58,152,494 H579Q probably damaging Het
Tanc2 T A 11: 105,864,007 V559E probably benign Het
Trp53bp1 A G 2: 121,199,749 Y1762H probably damaging Het
Usp15 T C 10: 123,146,921 Y263C possibly damaging Het
Usp17ld A T 7: 103,250,288 V479E probably damaging Het
Vmn2r15 A T 5: 109,293,319 S224R possibly damaging Het
Vmn2r8 A T 5: 108,801,834 N382K probably benign Het
Vmn2r94 T C 17: 18,257,397 I251V probably benign Het
Wnt2b A T 3: 104,947,092 V350D possibly damaging Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70579342 missense probably damaging 1.00
IGL01755:Sltm APN 9 70583922 splice site probably null
IGL01782:Sltm APN 9 70573641 missense probably damaging 1.00
IGL02441:Sltm APN 9 70587185 missense probably damaging 1.00
IGL02831:Sltm APN 9 70584865 missense probably damaging 1.00
IGL02947:Sltm APN 9 70591664 missense probably benign 0.05
IGL03166:Sltm APN 9 70542969 missense possibly damaging 0.87
R0288:Sltm UTSW 9 70579351 missense probably damaging 1.00
R0555:Sltm UTSW 9 70586081 missense probably damaging 1.00
R0815:Sltm UTSW 9 70561908 missense probably benign 0.04
R0863:Sltm UTSW 9 70561908 missense probably benign 0.04
R1315:Sltm UTSW 9 70543065 missense probably benign 0.13
R1533:Sltm UTSW 9 70586666 missense probably damaging 1.00
R1676:Sltm UTSW 9 70573647 missense probably damaging 1.00
R1764:Sltm UTSW 9 70561800 missense probably benign 0.00
R1845:Sltm UTSW 9 70543032 missense possibly damaging 0.60
R2049:Sltm UTSW 9 70581301 missense probably benign 0.00
R2163:Sltm UTSW 9 70591682 missense probably damaging 0.99
R3410:Sltm UTSW 9 70585958 missense probably damaging 0.97
R4323:Sltm UTSW 9 70580247 missense probably benign
R4632:Sltm UTSW 9 70579369 missense possibly damaging 0.86
R4748:Sltm UTSW 9 70581365 missense probably damaging 1.00
R4756:Sltm UTSW 9 70591610 missense possibly damaging 0.57
R4782:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4799:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4887:Sltm UTSW 9 70588978 missense probably damaging 1.00
R5221:Sltm UTSW 9 70579403 missense probably damaging 1.00
R5263:Sltm UTSW 9 70584799 missense unknown
R5982:Sltm UTSW 9 70586804 missense probably damaging 1.00
R6297:Sltm UTSW 9 70581359 missense probably damaging 0.99
R6456:Sltm UTSW 9 70542987 missense probably damaging 1.00
R6658:Sltm UTSW 9 70581362 missense probably damaging 1.00
R6720:Sltm UTSW 9 70573710 missense probably damaging 1.00
R6770:Sltm UTSW 9 70584777 missense unknown
R6923:Sltm UTSW 9 70574610 missense probably damaging 1.00
R7051:Sltm UTSW 9 70559066 missense probably damaging 1.00
R7166:Sltm UTSW 9 70584850 missense probably damaging 1.00
R7257:Sltm UTSW 9 70543965 splice site probably null
R7400:Sltm UTSW 9 70586070 missense probably damaging 1.00
R7438:Sltm UTSW 9 70573466 missense unknown
R7484:Sltm UTSW 9 70573897 missense unknown
R7630:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7631:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7632:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7633:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7862:Sltm UTSW 9 70572164 nonsense probably null
R7885:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7886:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7888:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7889:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7891:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7915:Sltm UTSW 9 70587149 missense probably damaging 1.00
R8030:Sltm UTSW 9 70585979 nonsense probably null
R8062:Sltm UTSW 9 70573497 missense unknown
R8374:Sltm UTSW 9 70561945 missense probably null
R8698:Sltm UTSW 9 70587070 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ATCCAAAAGAACGCTGTTTGG -3'
(R):5'- TTCCAGTTGAAGGTAAGAAGACCAC -3'

Sequencing Primer
(F):5'- CAAAAGAACGCTGTTTGGTAATTATC -3'
(R):5'- TTGAAGGTAAGAAGACCACAGCACTC -3'
Posted On2020-06-30