Incidental Mutation 'R7891:Sltm'
ID609341
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene NameSAFB-like, transcription modulator
Synonyms9130215G10Rik, 5730555F13Rik, 5730455C01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R7891 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location70542754-70592234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 70586673 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 802 (P802R)
Ref Sequence ENSEMBL: ENSMUSP00000049112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000216816] [ENSMUST00000217593]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049263
AA Change: P802R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: P802R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216816
AA Change: P784R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000217593
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T G 2: 165,078,944 E56D unknown Het
9930111J21Rik2 T C 11: 49,019,716 Q630R probably benign Het
Abca9 A G 11: 110,163,272 V68A probably benign Het
Acnat1 G A 4: 49,449,181 A195V possibly damaging Het
Acsl3 C T 1: 78,703,588 A612V probably benign Het
Adam12 A T 7: 133,998,232 D115E probably benign Het
Adam3 T A 8: 24,707,497 probably null Het
Aif1 G A 17: 35,172,624 probably benign Het
Ank3 A G 10: 69,988,309 D154G probably damaging Het
Arid3b A G 9: 57,810,159 C233R probably benign Het
Ccdc7b T A 8: 129,072,665 D74E unknown Het
Cckbr T A 7: 105,435,350 D430E probably benign Het
Chpf T C 1: 75,475,295 H667R probably benign Het
Dnah8 A G 17: 30,712,289 E1426G probably benign Het
Dync1h1 A G 12: 110,643,156 I2791V probably benign Het
Ehd3 A G 17: 73,816,392 N130S probably benign Het
Fam198b G A 3: 79,886,284 A20T probably benign Het
Fgfr4 A G 13: 55,159,151 T218A probably benign Het
Foxe1 G A 4: 46,344,599 E136K possibly damaging Het
Frmpd1 A G 4: 45,284,478 S1100G probably benign Het
Gm21886 T G 18: 80,089,757 Q62P probably null Het
Golga4 A G 9: 118,556,366 E852G probably damaging Het
Gprin3 T C 6: 59,353,711 D537G probably benign Het
Gpx5 C A 13: 21,288,748 D139Y probably damaging Het
Hmcn1 T C 1: 150,593,189 Y5007C probably damaging Het
Igsf10 G A 3: 59,328,411 R1450* probably null Het
Kif21a G A 15: 90,956,314 P1200S probably damaging Het
Kmt2c G A 5: 25,300,111 R3400C probably damaging Het
Miox A C 15: 89,336,539 M216L probably benign Het
Mphosph9 T C 5: 124,290,904 Y687C probably damaging Het
Mxi1 T A 19: 53,310,761 V21D probably benign Het
Nbeal1 T C 1: 60,260,432 L1309P probably benign Het
Olfr1116 A T 2: 87,269,077 T99S possibly damaging Het
Olfr1186 G A 2: 88,525,945 V121I probably benign Het
Olfr272 C T 4: 52,911,663 V44I probably benign Het
Olfr837 T C 9: 19,137,845 M284T possibly damaging Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Polq A G 16: 37,027,882 T284A probably damaging Het
Polrmt A T 10: 79,741,880 M295K probably damaging Het
Pou2af1 G T 9: 51,232,997 M70I probably damaging Het
Pou3f1 G A 4: 124,658,439 E245K probably damaging Het
Psmb1 C T 17: 15,494,486 V50I probably benign Het
Ptgis T C 2: 167,227,514 D50G probably damaging Het
R3hdm2 A G 10: 127,498,574 I955M probably benign Het
Rasef G A 4: 73,759,698 T97I probably benign Het
Rasef T C 4: 73,790,964 T11A probably benign Het
Sema4c C A 1: 36,549,914 L710F probably damaging Het
Slc39a10 C T 1: 46,812,168 A721T probably damaging Het
Spata31d1a A G 13: 59,700,325 C1330R possibly damaging Het
Susd1 T C 4: 59,349,915 D560G possibly damaging Het
Tnfrsf1b T C 4: 145,229,090 Y32C probably damaging Het
Trhr2 C A 8: 122,357,344 V306F probably damaging Het
Trpm6 A T 19: 18,776,710 Q35L probably benign Het
Ttbk2 A G 2: 120,786,029 S197P probably damaging Het
Uggt2 T A 14: 119,042,647 E806D probably benign Het
Ushbp1 T G 8: 71,388,778 Q469P possibly damaging Het
Vmn1r73 G A 7: 11,757,109 V285I possibly damaging Het
Zfp934 A C 13: 62,520,189 S63R probably benign Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70579342 missense probably damaging 1.00
IGL01755:Sltm APN 9 70583922 splice site probably null
IGL01782:Sltm APN 9 70573641 missense probably damaging 1.00
IGL02441:Sltm APN 9 70587185 missense probably damaging 1.00
IGL02831:Sltm APN 9 70584865 missense probably damaging 1.00
IGL02947:Sltm APN 9 70591664 missense probably benign 0.05
IGL03166:Sltm APN 9 70542969 missense possibly damaging 0.87
R0288:Sltm UTSW 9 70579351 missense probably damaging 1.00
R0555:Sltm UTSW 9 70586081 missense probably damaging 1.00
R0815:Sltm UTSW 9 70561908 missense probably benign 0.04
R0863:Sltm UTSW 9 70561908 missense probably benign 0.04
R1315:Sltm UTSW 9 70543065 missense probably benign 0.13
R1533:Sltm UTSW 9 70586666 missense probably damaging 1.00
R1676:Sltm UTSW 9 70573647 missense probably damaging 1.00
R1764:Sltm UTSW 9 70561800 missense probably benign 0.00
R1845:Sltm UTSW 9 70543032 missense possibly damaging 0.60
R2049:Sltm UTSW 9 70581301 missense probably benign 0.00
R2163:Sltm UTSW 9 70591682 missense probably damaging 0.99
R3410:Sltm UTSW 9 70585958 missense probably damaging 0.97
R4323:Sltm UTSW 9 70580247 missense probably benign
R4632:Sltm UTSW 9 70579369 missense possibly damaging 0.86
R4748:Sltm UTSW 9 70581365 missense probably damaging 1.00
R4756:Sltm UTSW 9 70591610 missense possibly damaging 0.57
R4782:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4799:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4887:Sltm UTSW 9 70588978 missense probably damaging 1.00
R5221:Sltm UTSW 9 70579403 missense probably damaging 1.00
R5263:Sltm UTSW 9 70584799 missense unknown
R5982:Sltm UTSW 9 70586804 missense probably damaging 1.00
R6297:Sltm UTSW 9 70581359 missense probably damaging 0.99
R6456:Sltm UTSW 9 70542987 missense probably damaging 1.00
R6658:Sltm UTSW 9 70581362 missense probably damaging 1.00
R6720:Sltm UTSW 9 70573710 missense probably damaging 1.00
R6770:Sltm UTSW 9 70584777 missense unknown
R6923:Sltm UTSW 9 70574610 missense probably damaging 1.00
R7051:Sltm UTSW 9 70559066 missense probably damaging 1.00
R7166:Sltm UTSW 9 70584850 missense probably damaging 1.00
R7257:Sltm UTSW 9 70543965 splice site probably null
R7400:Sltm UTSW 9 70586070 missense probably damaging 1.00
R7438:Sltm UTSW 9 70573466 missense unknown
R7484:Sltm UTSW 9 70573897 missense unknown
R7630:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7631:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7632:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7633:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7862:Sltm UTSW 9 70572164 nonsense probably null
R7885:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7886:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7888:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7889:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7915:Sltm UTSW 9 70587149 missense probably damaging 1.00
R8030:Sltm UTSW 9 70585979 nonsense probably null
R8062:Sltm UTSW 9 70573497 missense unknown
R8099:Sltm UTSW 9 70586078 missense probably damaging 1.00
R8374:Sltm UTSW 9 70561945 missense probably null
R8698:Sltm UTSW 9 70587070 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CAGTAATGAGGGCTTTTCTGGC -3'
(R):5'- TCTAGAAGGATTGGGCACAGTC -3'

Sequencing Primer
(F):5'- GCAGCCTTGCCATAATTTCC -3'
(R):5'- AAGGATTGGGCACAGTCTCTCG -3'
Posted On2019-12-20