Incidental Mutation 'R8698:Sltm'
ID668856
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene NameSAFB-like, transcription modulator
Synonyms9130215G10Rik, 5730555F13Rik, 5730455C01Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R8698 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location70542754-70592234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70587070 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 901 (S901P)
Ref Sequence ENSEMBL: ENSMUSP00000049112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000216816] [ENSMUST00000217593]
Predicted Effect probably benign
Transcript: ENSMUST00000049263
AA Change: S901P

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: S901P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216816
AA Change: S883P

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217593
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A G 15: 102,338,815 probably benign Het
Adamtsl1 A G 4: 86,388,477 N1384S probably benign Het
Adgre1 T C 17: 57,402,003 S65P probably benign Het
Adgrl4 G T 3: 151,497,875 C124F probably damaging Het
Aldh1b1 G A 4: 45,802,942 G160D probably damaging Het
Alpi T G 1: 87,100,486 D205A probably damaging Het
AW146154 C A 7: 41,480,510 R394L probably benign Het
Bcl10 G A 3: 145,933,267 M221I probably benign Het
Brpf3 G A 17: 28,818,462 R768H probably damaging Het
Cad G T 5: 31,077,475 R2116L probably benign Het
Cand2 G T 6: 115,786,891 R258L probably damaging Het
Car4 A T 11: 84,964,183 N119I probably benign Het
Carmil1 C T 13: 24,036,246 G1165D probably damaging Het
Ccdc66 T C 14: 27,490,690 T403A probably benign Het
Cdon T G 9: 35,486,973 probably null Het
Cemip T C 7: 83,958,582 I739V probably damaging Het
Cep85l A G 10: 53,358,105 I59T probably damaging Het
Clec4f A T 6: 83,653,285 V97D probably benign Het
Cnot6l A G 5: 96,077,290 C515R probably damaging Het
Cntnap2 G A 6: 47,049,222 G935D probably damaging Het
Cntrl A G 2: 35,133,962 H553R probably damaging Het
Cops3 A G 11: 59,818,060 S423P probably damaging Het
Cox15 C T 19: 43,751,509 R39H probably benign Het
Ctnna2 A G 6: 77,653,117 V131A probably benign Het
Dcst2 T A 3: 89,368,737 F392I probably benign Het
Decr1 A G 4: 15,922,483 probably null Het
Dennd3 A C 15: 73,522,305 T60P possibly damaging Het
Dmxl2 T C 9: 54,374,669 N2859S probably benign Het
Dnah12 A T 14: 26,707,263 I280F probably benign Het
Dnah8 A C 17: 30,875,035 D4701A probably damaging Het
Dyrk1a C A 16: 94,686,555 H541Q possibly damaging Het
Eml4 T C 17: 83,477,916 S906P probably benign Het
Fam129c T A 8: 71,607,515 I93N unknown Het
Fam169a G T 13: 97,107,070 V203F probably damaging Het
Fam69a A T 5: 107,909,910 F261I probably damaging Het
Fmn1 C T 2: 113,429,807 L682F unknown Het
Gli2 T C 1: 118,842,157 Y555C probably damaging Het
Gm3278 A G 14: 4,894,467 Y130C possibly damaging Het
Gm8237 T A 14: 5,863,554 Y37F probably damaging Het
Golga4 T G 9: 118,555,961 L717R probably damaging Het
Gtpbp4 C T 13: 8,974,213 R568H probably benign Het
Il1f10 A G 2: 24,293,185 N47S probably damaging Het
Itga6 A G 2: 71,843,274 H884R probably benign Het
Kdm1a T C 4: 136,559,207 K482R probably benign Het
Klk12 T C 7: 43,769,689 V26A probably benign Het
Lrp2 T A 2: 69,448,239 R3923S probably benign Het
Lrp2 C T 2: 69,458,423 V3700M probably benign Het
Lrrk2 A G 15: 91,752,197 D1458G probably benign Het
Mapre2 T A 18: 23,878,033 S233T probably benign Het
Mki67 T C 7: 135,695,208 D2699G possibly damaging Het
Mthfr T A 4: 148,044,490 Y214* probably null Het
Ncoa6 A T 2: 155,415,121 M834K possibly damaging Het
Neurl2 C T 2: 164,833,134 D103N probably benign Het
Olfr1535 G A 13: 21,555,720 L101F probably damaging Het
Olfr344 T C 2: 36,568,903 Y102H possibly damaging Het
Olfr698 A T 7: 106,753,364 V8E probably benign Het
P2ry14 A G 3: 59,115,175 V288A possibly damaging Het
Pde6b G T 5: 108,428,239 S730I possibly damaging Het
Pdpk1 A T 17: 24,079,568 V496D probably damaging Het
Plekho2 A T 9: 65,556,272 L432M probably damaging Het
Ppa2 T C 3: 133,376,601 L151P unknown Het
Ppp2r3c G A 12: 55,281,714 T422I probably benign Het
Prelid3a T C 18: 67,477,052 S151P probably damaging Het
Rad21l G A 2: 151,645,453 P537L probably damaging Het
Sacs T A 14: 61,213,353 S4283T probably benign Het
Samd9l A T 6: 3,373,843 D1139E probably benign Het
Scn9a G T 2: 66,536,284 H718Q probably benign Het
Slc1a3 A T 15: 8,639,152 I443N probably damaging Het
Slc22a6 A G 19: 8,623,525 M361V probably benign Het
Slc8a2 A G 7: 16,157,207 Y724C probably damaging Het
Slf1 A T 13: 77,049,165 S777T possibly damaging Het
Smc1b A T 15: 85,112,846 H524Q probably benign Het
Spast T C 17: 74,359,346 S225P probably benign Het
Srsf12 C T 4: 33,231,246 R252W probably damaging Het
Syne1 A G 10: 5,229,229 L4415P probably damaging Het
Tmem117 A T 15: 94,638,109 Y8F probably benign Het
Tmem241 T C 18: 12,064,231 D180G possibly damaging Het
Tomm40 C T 7: 19,710,965 V164I probably benign Het
Ttc41 T C 10: 86,712,977 Y12H probably benign Het
Twnk T C 19: 45,007,860 V244A probably benign Het
Ugt1a8 T C 1: 88,088,230 S122P probably damaging Het
Vmn1r78 A G 7: 12,152,612 K50R probably benign Het
Vmn2r10 A G 5: 109,003,524 F75L probably benign Het
Wbp4 G T 14: 79,470,133 Y179* probably null Het
Zfp106 A G 2: 120,524,119 probably null Het
Zfp974 A T 7: 27,910,936 C455S possibly damaging Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70579342 missense probably damaging 1.00
IGL01755:Sltm APN 9 70583922 splice site probably null
IGL01782:Sltm APN 9 70573641 missense probably damaging 1.00
IGL02441:Sltm APN 9 70587185 missense probably damaging 1.00
IGL02831:Sltm APN 9 70584865 missense probably damaging 1.00
IGL02947:Sltm APN 9 70591664 missense probably benign 0.05
IGL03166:Sltm APN 9 70542969 missense possibly damaging 0.87
R0288:Sltm UTSW 9 70579351 missense probably damaging 1.00
R0555:Sltm UTSW 9 70586081 missense probably damaging 1.00
R0815:Sltm UTSW 9 70561908 missense probably benign 0.04
R0863:Sltm UTSW 9 70561908 missense probably benign 0.04
R1315:Sltm UTSW 9 70543065 missense probably benign 0.13
R1533:Sltm UTSW 9 70586666 missense probably damaging 1.00
R1676:Sltm UTSW 9 70573647 missense probably damaging 1.00
R1764:Sltm UTSW 9 70561800 missense probably benign 0.00
R1845:Sltm UTSW 9 70543032 missense possibly damaging 0.60
R2049:Sltm UTSW 9 70581301 missense probably benign 0.00
R2163:Sltm UTSW 9 70591682 missense probably damaging 0.99
R3410:Sltm UTSW 9 70585958 missense probably damaging 0.97
R4323:Sltm UTSW 9 70580247 missense probably benign
R4632:Sltm UTSW 9 70579369 missense possibly damaging 0.86
R4748:Sltm UTSW 9 70581365 missense probably damaging 1.00
R4756:Sltm UTSW 9 70591610 missense possibly damaging 0.57
R4782:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4799:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4887:Sltm UTSW 9 70588978 missense probably damaging 1.00
R5221:Sltm UTSW 9 70579403 missense probably damaging 1.00
R5263:Sltm UTSW 9 70584799 missense unknown
R5982:Sltm UTSW 9 70586804 missense probably damaging 1.00
R6297:Sltm UTSW 9 70581359 missense probably damaging 0.99
R6456:Sltm UTSW 9 70542987 missense probably damaging 1.00
R6658:Sltm UTSW 9 70581362 missense probably damaging 1.00
R6720:Sltm UTSW 9 70573710 missense probably damaging 1.00
R6770:Sltm UTSW 9 70584777 missense unknown
R6923:Sltm UTSW 9 70574610 missense probably damaging 1.00
R7051:Sltm UTSW 9 70559066 missense probably damaging 1.00
R7166:Sltm UTSW 9 70584850 missense probably damaging 1.00
R7257:Sltm UTSW 9 70543965 splice site probably null
R7400:Sltm UTSW 9 70586070 missense probably damaging 1.00
R7438:Sltm UTSW 9 70573466 missense unknown
R7484:Sltm UTSW 9 70573897 missense unknown
R7630:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7631:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7632:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7633:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7862:Sltm UTSW 9 70572164 nonsense probably null
R7885:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7886:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7888:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7889:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7891:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7915:Sltm UTSW 9 70587149 missense probably damaging 1.00
R8030:Sltm UTSW 9 70585979 nonsense probably null
R8062:Sltm UTSW 9 70573497 missense unknown
R8099:Sltm UTSW 9 70586078 missense probably damaging 1.00
R8374:Sltm UTSW 9 70561945 missense probably null
Predicted Primers PCR Primer
(F):5'- CAACTTCCTGGAAAAGCGAAG -3'
(R):5'- ACGGATCCAAATTCTGTCTGGC -3'

Sequencing Primer
(F):5'- CGAAGCGAATATGTCCACAGAG -3'
(R):5'- GTAACTCTAGTTCCAGGAGACCTG -3'
Posted On2021-04-30