Incidental Mutation 'R8142:Pon2'
ID632581
Institutional Source Beutler Lab
Gene Symbol Pon2
Ensembl Gene ENSMUSG00000032667
Gene Nameparaoxonase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8142 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location5264147-5298455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5266239 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 260 (V260D)
Ref Sequence ENSEMBL: ENSMUSP00000062670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057792]
Predicted Effect probably benign
Transcript: ENSMUST00000057792
AA Change: V260D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000062670
Gene: ENSMUSG00000032667
AA Change: V260D

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:SGL 107 303 1e-12 PFAM
Pfam:Arylesterase 167 252 3.9e-43 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed an atherogenic diet, mice homozygous for a gene trapped allele show markedly lower VLDL/LDL cholesterol and serum apoB levels, higher cellular oxidative stress, enhanced macrophage immunoreactivity and LDL-induced monocyte chemotaxis, and largeratheromatous lesions than wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Pon2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Pon2 APN 6 5272331 missense probably damaging 1.00
IGL02683:Pon2 APN 6 5269062 missense probably damaging 1.00
IGL03240:Pon2 APN 6 5265316 utr 3 prime probably benign
R0102:Pon2 UTSW 6 5289091 splice site probably benign
R0102:Pon2 UTSW 6 5289091 splice site probably benign
R0360:Pon2 UTSW 6 5266156 nonsense probably null
R0364:Pon2 UTSW 6 5266156 nonsense probably null
R0402:Pon2 UTSW 6 5272410 nonsense probably null
R0494:Pon2 UTSW 6 5267059 splice site probably benign
R1593:Pon2 UTSW 6 5273003 missense probably benign
R3001:Pon2 UTSW 6 5268976 critical splice donor site probably null
R3002:Pon2 UTSW 6 5268976 critical splice donor site probably null
R3236:Pon2 UTSW 6 5266986 missense possibly damaging 0.59
R4467:Pon2 UTSW 6 5267021 missense probably benign 0.24
R4911:Pon2 UTSW 6 5269029 missense possibly damaging 0.93
R5237:Pon2 UTSW 6 5265455 missense probably benign
R6025:Pon2 UTSW 6 5289057 missense probably benign 0.40
R6313:Pon2 UTSW 6 5272421 missense probably damaging 1.00
R6737:Pon2 UTSW 6 5266183 missense probably benign 0.04
R7427:Pon2 UTSW 6 5268995 missense probably damaging 0.99
R7438:Pon2 UTSW 6 5289080 missense probably benign
R7517:Pon2 UTSW 6 5268997 missense possibly damaging 0.91
R8318:Pon2 UTSW 6 5265425 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCCGTGACAGTTTATTCCATTATTAG -3'
(R):5'- CTTTTAAGGCAAAAGGGGTGCG -3'

Sequencing Primer
(F):5'- TCCATTATTAGTGCAAAGGACTTG -3'
(R):5'- GCAAAAGGGGTGCGTTATTATTATC -3'
Posted On2020-06-30