Mutagenetix > Incidental Mutation

Incidental Mutation 'R8142:Slc1a4'

632594

Institutional Source

Beutler Lab

Gene Symbol

Slc1a4

Ensembl Gene

ENSMUSG00000020142

Gene Name

solute carrier family 1 (glutamate/neutral amino acid transporter), member 4

Synonyms

ASCT1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8142 (G1)

Quality Score

172.009

Status

Not validated

Chromosome

Chromosomal Location

20302180-20332713 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 20307890 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105223 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004634] [ENSMUST00000109594]

AlphaFold

O35874

Predicted Effect

probably null
Transcript: ENSMUST00000004634

SMART Domains

Protein: ENSMUSP00000004634
Gene: ENSMUSG00000020142

Domain	Start	End	E-Value	Type
Pfam:SDF	1	397	2.7e-121	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000109594

SMART Domains

Protein: ENSMUSP00000105223
Gene: ENSMUSG00000020142

Domain	Start	End	E-Value	Type
Pfam:SDF	44	477	4.2e-121	PFAM

Coding Region Coverage

1x: 99.7%
3x: 99.5%
10x: 98.0%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-dependent neutral amino acid transporter for alanine, serine, cysteine, and threonine. Defects in this gene have been associated with developmental delay, microcephaly, and intellectual disability. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp6v1e2	A	T	17: 86,944,655	I105N	possibly damaging	Het
Azi2	A	G	9: 118,049,407	D105G	probably damaging	Het
Bmpr2	T	C	1: 59,870,306	S980P	probably damaging	Het
Ccno	T	G	13: 112,988,955	L151R	probably damaging	Het
Cdh2	A	C	18: 16,601,734	I801S	probably benign	Het
Cyp2f2	G	A	7: 27,129,253	V183I	probably benign	Het
Dab1	T	A	4: 104,678,724	V110D	probably damaging	Het
Dnah3	T	C	7: 120,060,966	T828A	probably benign	Het
Dnah5	G	T	15: 28,384,373	V3088L	probably benign	Het
Dtd2	T	A	12: 51,999,810	D82V	probably damaging	Het
Dusp5	T	C	19: 53,537,481	F185L	probably damaging	Het
Epha10	A	G	4: 124,885,846	T162A	probably damaging	Het
Fat4	A	T	3: 38,891,203	D1415V	probably damaging	Het
Fitm1	T	C	14: 55,575,790	Y37H	possibly damaging	Het
Flg2	G	T	3: 93,215,475	E1651*	probably null	Het
Gm15922	A	G	7: 3,736,843	S418P	possibly damaging	Het
Ifit3	G	T	19: 34,587,501	C149F	probably damaging	Het
Lepr	C	A	4: 101,765,419	H465Q	possibly damaging	Het
Ltn1	A	C	16: 87,381,641	S1567A	probably benign	Het
March1	T	C	8: 66,456,126	V166A	probably benign	Het
Marveld2	T	C	13: 100,600,940	H424R	possibly damaging	Het
Mypop	A	G	7: 19,001,126	T383A	unknown	Het
Ngef	G	C	1: 87,540,741	R99G	probably benign	Het
Npepps	G	T	11: 97,218,572	A726D	probably damaging	Het
Olfr766-ps1	T	A	10: 129,064,650	D9V	probably benign	Het
Pcdhgb4	A	G	18: 37,721,113	D187G	probably damaging	Het
Pdzd3	A	G	9: 44,250,781		probably null	Het
Per2	T	C	1: 91,421,547	E1034G	possibly damaging	Het
Pkhd1l1	G	A	15: 44,514,931	R1027H	probably benign	Het
Pon2	A	T	6: 5,266,239	V260D	probably benign	Het
Rnase13	A	G	14: 51,922,436	I82T	probably damaging	Het
Sbno1	A	G	5: 124,408,545	S194P	probably benign	Het
Serpinb6c	T	A	13: 33,880,113	I320L	probably benign	Het
Sh3rf3	C	T	10: 59,049,383	R363*	probably null	Het
Slc11a1	T	C	1: 74,385,259	F500L	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Sorcs2	T	C	5: 36,062,614	N362S	possibly damaging	Het
Stau2	A	G	1: 16,460,351	S115P	unknown	Het
Stk38l	A	G	6: 146,758,572	N34S	probably benign	Het
Tmem201	T	C	4: 149,718,657	T585A	probably benign	Het
Ttc6	A	T	12: 57,697,472	I1297F	possibly damaging	Het
Uncx	A	G	5: 139,546,900	D240G	possibly damaging	Het
Vmn2r88	A	G	14: 51,414,107	I293V		Het
Vps11	T	C	9: 44,354,555	T476A	probably benign	Het
Vrtn	T	C	12: 84,650,621	L715P	probably damaging	Het
Wdr72	T	G	9: 74,139,667	V65G	probably damaging	Het
Zbtb21	T	C	16: 97,951,475	E536G	probably damaging	Het
Zbtb34	G	T	2: 33,412,481	S16*	probably null	Het
Zfhx2	G	A	14: 55,073,438	L600F	possibly damaging	Het

Other mutations in Slc1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01141:Slc1a4	APN	11	20308644	splice site	probably benign
IGL01889:Slc1a4	APN	11	20314089	splice site	probably benign
IGL02725:Slc1a4	APN	11	20308408	missense	probably damaging	1.00
IGL03409:Slc1a4	APN	11	20306506	missense	probably damaging	1.00
G1Funyon:Slc1a4	UTSW	11	20332286	missense	probably damaging	1.00
R0085:Slc1a4	UTSW	11	20304510	splice site	probably benign
R0771:Slc1a4	UTSW	11	20306467	missense	probably damaging	1.00
R0898:Slc1a4	UTSW	11	20304349	missense	probably damaging	1.00
R1326:Slc1a4	UTSW	11	20332159	missense	probably damaging	1.00
R1992:Slc1a4	UTSW	11	20304375	missense	probably benign	0.31
R2497:Slc1a4	UTSW	11	20332620	start gained	probably benign
R3498:Slc1a4	UTSW	11	20313973	missense	probably damaging	1.00
R4608:Slc1a4	UTSW	11	20304348	missense	probably damaging	1.00
R4631:Slc1a4	UTSW	11	20308452	missense	probably damaging	1.00
R4885:Slc1a4	UTSW	11	20304384	missense	probably damaging	1.00
R4911:Slc1a4	UTSW	11	20332166	missense	probably damaging	1.00
R5533:Slc1a4	UTSW	11	20304417	missense	probably benign	0.01
R5548:Slc1a4	UTSW	11	20304429	missense	possibly damaging	0.68
R6523:Slc1a4	UTSW	11	20332114	missense	probably damaging	1.00
R6863:Slc1a4	UTSW	11	20314001	missense	probably damaging	1.00
R6941:Slc1a4	UTSW	11	20304346	missense	probably damaging	1.00
R7508:Slc1a4	UTSW	11	20306487	missense	probably damaging	1.00
R7747:Slc1a4	UTSW	11	20308587	missense	probably damaging	1.00
R7748:Slc1a4	UTSW	11	20332252	missense	probably damaging	1.00
R7934:Slc1a4	UTSW	11	20308518	missense	probably damaging	1.00
R8301:Slc1a4	UTSW	11	20332286	missense	probably damaging	1.00
R8398:Slc1a4	UTSW	11	20307982	missense	probably damaging	1.00
R8827:Slc1a4	UTSW	11	20320237	splice site	probably benign
R9031:Slc1a4	UTSW	11	20332532	start gained	probably benign
R9132:Slc1a4	UTSW	11	20308527	missense	probably damaging	1.00
R9280:Slc1a4	UTSW	11	20332325	missense	probably damaging	1.00
R9352:Slc1a4	UTSW	11	20332025	missense	probably damaging	0.97
R9548:Slc1a4	UTSW	11	20308041	missense	probably damaging	1.00
R9616:Slc1a4	UTSW	11	20332403	missense	probably benign
X0025:Slc1a4	UTSW	11	20318703	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTAAGATGGTCCTGGAACGG -3'
(R):5'- CCGTCTATGATGAAGTGCATTG -3'

Sequencing Primer
(F):5'- TGTAGGTAGCACCATACCATAGCTAG -3'
(R):5'- CGTCTATGATGAAGTGCATTGAGGAG -3'

Posted On

2020-06-30