Incidental Mutation 'R8142:Cdh2'
ID632611
Institutional Source Beutler Lab
Gene Symbol Cdh2
Ensembl Gene ENSMUSG00000024304
Gene Namecadherin 2
SynonymsNcad, N-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8142 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location16588877-16809246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 16601734 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 801 (I801S)
Ref Sequence ENSEMBL: ENSMUSP00000025166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025166] [ENSMUST00000115850]
PDB Structure
STRUCTURAL BASIS OF CELL-CELL ADHESION BY CADHERINS [X-RAY DIFFRACTION]
STRUCTURAL BASIS OF CELL-CELL ADHESION BY CADHERINS [X-RAY DIFFRACTION]
STRUCTURAL BASIS OF CELL-CELL ADHESION BY CADHERINS [X-RAY DIFFRACTION]
N-CADHERIN, TWO-DOMAIN FRAGMENT [X-RAY DIFFRACTION]
Solution Structure of Neural Cadherin Prodomain [SOLUTION NMR]
Crystal structure of N-cadherin domains EC12 [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin ectodomain [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin EC1-2 A78SI92M [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin EC1-2 with AA insertion between residues 2 and 3 [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin EC1-2 W2F [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025166
AA Change: I801S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025166
Gene: ENSMUSG00000024304
AA Change: I801S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Cadherin_pro 31 123 5.77e-34 SMART
low complexity region 129 141 N/A INTRINSIC
CA 182 265 3.37e-17 SMART
CA 289 380 2.15e-33 SMART
CA 403 496 4.38e-16 SMART
CA 519 603 2.27e-23 SMART
CA 623 708 5.54e-2 SMART
transmembrane domain 724 746 N/A INTRINSIC
Pfam:Cadherin_C 753 903 6.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115850
AA Change: I744S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111516
Gene: ENSMUSG00000024304
AA Change: I744S

DomainStartEndE-ValueType
Cadherin_pro 1 66 3.44e-9 SMART
low complexity region 72 84 N/A INTRINSIC
CA 125 208 3.37e-17 SMART
CA 232 323 2.15e-33 SMART
CA 346 439 4.38e-16 SMART
CA 462 546 2.27e-23 SMART
CA 566 651 5.54e-2 SMART
transmembrane domain 667 689 N/A INTRINSIC
Pfam:Cadherin_C 690 847 2.5e-57 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Mice lacking the encoded protein exhibit severe developmental defects resulting in embryonic death. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in death by E10. Mutant embryos exhibit several developmental abnormalities such as growth retardation, an enlarged heart, distended pericardial sacs, abnormal heart tube, wavy neural tube, irregular somite shape,and abnormal embryo turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Cdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Cdh2 APN 18 16627636 missense possibly damaging 0.69
IGL01560:Cdh2 APN 18 16650438 missense probably benign 0.01
IGL02028:Cdh2 APN 18 16650420 missense probably benign 0.07
IGL02227:Cdh2 APN 18 16629586 missense probably benign 0.01
IGL02229:Cdh2 APN 18 16624753 missense probably benign
IGL02617:Cdh2 APN 18 16627604 missense probably damaging 1.00
IGL02685:Cdh2 APN 18 16646500 missense probably damaging 1.00
IGL02724:Cdh2 APN 18 16629480 missense probably benign 0.29
R0111:Cdh2 UTSW 18 16774509 missense probably benign
R0173:Cdh2 UTSW 18 16650257 splice site probably benign
R0197:Cdh2 UTSW 18 16629576 missense probably benign
R0563:Cdh2 UTSW 18 16629681 missense possibly damaging 0.90
R0883:Cdh2 UTSW 18 16629576 missense probably benign
R1083:Cdh2 UTSW 18 16643959 missense possibly damaging 0.61
R1270:Cdh2 UTSW 18 16627557 splice site probably benign
R1469:Cdh2 UTSW 18 16624267 missense possibly damaging 0.92
R1469:Cdh2 UTSW 18 16624267 missense possibly damaging 0.92
R1510:Cdh2 UTSW 18 16648594 missense probably benign
R1875:Cdh2 UTSW 18 16624877 missense probably benign
R2122:Cdh2 UTSW 18 16774543 missense probably benign 0.01
R2194:Cdh2 UTSW 18 16640448 missense probably damaging 1.00
R2254:Cdh2 UTSW 18 16643928 critical splice donor site probably null
R4471:Cdh2 UTSW 18 16774476 splice site probably null
R4501:Cdh2 UTSW 18 16629585 missense possibly damaging 0.53
R4620:Cdh2 UTSW 18 16648608 missense probably benign
R4832:Cdh2 UTSW 18 16627697 missense probably benign 0.01
R4944:Cdh2 UTSW 18 16650409 missense probably damaging 0.99
R4958:Cdh2 UTSW 18 16627565 splice site probably null
R5160:Cdh2 UTSW 18 16629587 missense probably damaging 0.99
R5190:Cdh2 UTSW 18 16650315 missense possibly damaging 0.54
R5446:Cdh2 UTSW 18 16646627 missense probably damaging 1.00
R5552:Cdh2 UTSW 18 16640463 missense possibly damaging 0.88
R5699:Cdh2 UTSW 18 16646522 nonsense probably null
R5912:Cdh2 UTSW 18 16640450 missense possibly damaging 0.79
R5949:Cdh2 UTSW 18 16601630 missense probably damaging 1.00
R6313:Cdh2 UTSW 18 16774522 missense probably benign 0.00
R6633:Cdh2 UTSW 18 16640548 missense probably benign 0.00
R7822:Cdh2 UTSW 18 16624284 missense probably benign 0.24
R8022:Cdh2 UTSW 18 16590301 missense probably damaging 1.00
R8152:Cdh2 UTSW 18 16629519 missense probably benign 0.02
R8188:Cdh2 UTSW 18 16648536 missense probably damaging 1.00
R8461:Cdh2 UTSW 18 16650465 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CACTGGTTACTTGCCACTGC -3'
(R):5'- GAAGAACTCCCAGTGGCAAC -3'

Sequencing Primer
(F):5'- ACTTGCCACTGCTCTTATAACTAG -3'
(R):5'- GAAGAACTCCCAGTGGCAACTTTTC -3'
Posted On2020-06-30