Incidental Mutation 'R8157:Daam1'
ID633084
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Namedishevelled associated activator of morphogenesis 1
Synonyms1700066F09Rik, 2310028E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8157 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location71831078-71992333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71952489 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 633 (D633V)
Ref Sequence ENSEMBL: ENSMUSP00000082406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
Predicted Effect probably damaging
Transcript: ENSMUST00000085299
AA Change: D633V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574
AA Change: D633V

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221317
AA Change: D633V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223272
AA Change: D633V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T A 10: 80,319,527 R51W probably damaging Het
3110002H16Rik T C 18: 12,188,633 V497A possibly damaging Het
Adam3 A G 8: 24,707,437 I326T probably benign Het
Alpk3 A G 7: 81,093,722 K1096E probably benign Het
Aph1a T C 3: 95,894,838 V44A possibly damaging Het
Ash1l T A 3: 89,063,707 probably null Het
Atg2b A G 12: 105,662,940 M410T probably damaging Het
Ccdc15 C T 9: 37,315,457 G407D probably benign Het
Cd200r4 T A 16: 44,833,141 N137K probably damaging Het
Clec18a A G 8: 111,072,051 L438P probably damaging Het
Clip1 A G 5: 123,630,719 S606P probably benign Het
Col11a2 G A 17: 34,061,256 G1193E unknown Het
Col6a4 A G 9: 106,067,898 S1006P possibly damaging Het
Ctsc A T 7: 88,302,208 D221V probably benign Het
Ctse T C 1: 131,672,511 Y333H probably damaging Het
Cyp2c23 T C 19: 44,021,627 N93S probably benign Het
Dlg2 G A 7: 92,386,932 R607H probably damaging Het
Dsg2 T A 18: 20,580,549 D192E probably damaging Het
Dync2h1 A T 9: 7,001,473 N3838K possibly damaging Het
Ephx2 A C 14: 66,108,057 S153A probably damaging Het
Eprs C A 1: 185,398,394 H651N probably benign Het
Fat2 T C 11: 55,252,084 D4313G possibly damaging Het
Fras1 A G 5: 96,554,855 K252R probably benign Het
Galt A T 4: 41,757,226 Q193L probably benign Het
Gatsl2 T C 5: 134,137,097 F228S possibly damaging Het
Gm21964 A G 8: 110,108,861 M24V probably benign Het
Gm7356 T C 17: 14,001,321 K149E probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd1 T A 12: 51,791,290 R696S possibly damaging Het
Hydin A G 8: 110,452,036 I1088V probably benign Het
Igkv4-68 A T 6: 69,305,322 S14R probably benign Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldlrad4 C T 18: 68,254,222 R202* probably null Het
Lrit3 T C 3: 129,800,635 T98A probably benign Het
Macc1 A G 12: 119,445,993 I165M probably benign Het
Mapre2 T A 18: 23,858,161 M162K probably benign Het
Mzf1 T A 7: 13,044,352 H454L probably damaging Het
Naa30 T A 14: 49,173,408 N264K probably benign Het
Olfr199 A G 16: 59,215,989 V208A probably benign Het
Olfr924 T A 9: 38,848,466 Y117* probably null Het
Osr2 T C 15: 35,301,917 I221T probably benign Het
Pcdh12 A T 18: 38,282,797 I425K probably benign Het
Pcdhb3 T G 18: 37,303,239 Y753D probably damaging Het
Pcdhb9 T A 18: 37,403,155 V734E probably damaging Het
Pibf1 T A 14: 99,196,395 L593I probably benign Het
Ppp1r32 A T 19: 10,478,265 F207I probably damaging Het
Prag1 G A 8: 36,147,239 C1315Y probably damaging Het
Prl3c1 T C 13: 27,199,347 S19P probably damaging Het
Ptprz1 A T 6: 23,002,540 D1543V probably damaging Het
Ripor2 A G 13: 24,695,617 N356S probably benign Het
Scrib T C 15: 76,059,188 H914R possibly damaging Het
Sema6b G A 17: 56,128,448 A265V probably damaging Het
Tdrd9 C G 12: 111,985,066 L97V probably benign Het
Trabd T A 15: 89,085,821 L340H probably damaging Het
Trpm1 T C 7: 64,199,269 W88R probably damaging Het
Txndc12 G T 4: 108,853,222 probably null Het
Vmn1r175 T C 7: 23,809,098 I35V probably benign Het
Vmn1r48 A T 6: 90,036,012 V277E probably damaging Het
Vmn2r72 G A 7: 85,751,233 H203Y probably benign Het
Zbtb7c A G 18: 76,137,327 E162G probably benign Het
Zfp93 T A 7: 24,276,460 C623* probably null Het
Zzz3 A G 3: 152,449,648 I645V probably null Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0780:Daam1 UTSW 12 71947050 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1510:Daam1 UTSW 12 71977726 missense probably damaging 1.00
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1957:Daam1 UTSW 12 71982755 critical splice donor site probably null
R1974:Daam1 UTSW 12 71988929 missense probably damaging 0.99
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3161:Daam1 UTSW 12 71947098 missense unknown
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4635:Daam1 UTSW 12 71958744 splice site probably null
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5180:Daam1 UTSW 12 71947125 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5358:Daam1 UTSW 12 71952459 nonsense probably null
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6251:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6291:Daam1 UTSW 12 71946251 missense unknown
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7223:Daam1 UTSW 12 71988943 missense probably damaging 1.00
R7340:Daam1 UTSW 12 71988939 missense probably benign 0.28
R7467:Daam1 UTSW 12 71985806 nonsense probably null
R7709:Daam1 UTSW 12 71977649 missense probably benign 0.10
R7715:Daam1 UTSW 12 71988901 missense probably benign 0.15
R8187:Daam1 UTSW 12 71895828 missense unknown
R8297:Daam1 UTSW 12 71951915 missense unknown
R8963:Daam1 UTSW 12 71945244 missense unknown
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCAGCTCCTATGTTAGTTGAC -3'
(R):5'- CTGCTTTACAGGAACGCCTTG -3'

Sequencing Primer
(F):5'- CAGCTCCTATGTTAGTTGACAATGTC -3'
(R):5'- TTTACAGGAACGCCTTGGGGAG -3'
Posted On2020-06-30