Incidental Mutation 'R8157:Dsg2'
ID633102
Institutional Source Beutler Lab
Gene Symbol Dsg2
Ensembl Gene ENSMUSG00000044393
Gene Namedesmoglein 2
SynonymsD18Ertd293e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R8157 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20558074-20604521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20580549 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 192 (D192E)
Ref Sequence ENSEMBL: ENSMUSP00000057096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059787] [ENSMUST00000120102] [ENSMUST00000121837]
Predicted Effect probably damaging
Transcript: ENSMUST00000059787
AA Change: D192E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: D192E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
CA 298 392 1.94e-8 SMART
CA 418 502 2.34e-16 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 822 838 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120102
AA Change: D192E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113153
Gene: ENSMUSG00000044393
AA Change: D192E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
Pfam:Cadherin 282 347 6.9e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121837
AA Change: D192E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113029
Gene: ENSMUSG00000044393
AA Change: D192E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T A 10: 80,319,527 R51W probably damaging Het
3110002H16Rik T C 18: 12,188,633 V497A possibly damaging Het
Adam3 A G 8: 24,707,437 I326T probably benign Het
Alpk3 A G 7: 81,093,722 K1096E probably benign Het
Aph1a T C 3: 95,894,838 V44A possibly damaging Het
Ash1l T A 3: 89,063,707 probably null Het
Atg2b A G 12: 105,662,940 M410T probably damaging Het
Ccdc15 C T 9: 37,315,457 G407D probably benign Het
Cd200r4 T A 16: 44,833,141 N137K probably damaging Het
Clec18a A G 8: 111,072,051 L438P probably damaging Het
Clip1 A G 5: 123,630,719 S606P probably benign Het
Col11a2 G A 17: 34,061,256 G1193E unknown Het
Col6a4 A G 9: 106,067,898 S1006P possibly damaging Het
Ctsc A T 7: 88,302,208 D221V probably benign Het
Ctse T C 1: 131,672,511 Y333H probably damaging Het
Cyp2c23 T C 19: 44,021,627 N93S probably benign Het
Daam1 A T 12: 71,952,489 D633V probably damaging Het
Dlg2 G A 7: 92,386,932 R607H probably damaging Het
Dync2h1 A T 9: 7,001,473 N3838K possibly damaging Het
Ephx2 A C 14: 66,108,057 S153A probably damaging Het
Eprs C A 1: 185,398,394 H651N probably benign Het
Fat2 T C 11: 55,252,084 D4313G possibly damaging Het
Fras1 A G 5: 96,554,855 K252R probably benign Het
Galt A T 4: 41,757,226 Q193L probably benign Het
Gatsl2 T C 5: 134,137,097 F228S possibly damaging Het
Gm21964 A G 8: 110,108,861 M24V probably benign Het
Gm7356 T C 17: 14,001,321 K149E probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd1 T A 12: 51,791,290 R696S possibly damaging Het
Hydin A G 8: 110,452,036 I1088V probably benign Het
Igkv4-68 A T 6: 69,305,322 S14R probably benign Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldlrad4 C T 18: 68,254,222 R202* probably null Het
Lrit3 T C 3: 129,800,635 T98A probably benign Het
Macc1 A G 12: 119,445,993 I165M probably benign Het
Mapre2 T A 18: 23,858,161 M162K probably benign Het
Mzf1 T A 7: 13,044,352 H454L probably damaging Het
Naa30 T A 14: 49,173,408 N264K probably benign Het
Olfr199 A G 16: 59,215,989 V208A probably benign Het
Olfr924 T A 9: 38,848,466 Y117* probably null Het
Osr2 T C 15: 35,301,917 I221T probably benign Het
Pcdh12 A T 18: 38,282,797 I425K probably benign Het
Pcdhb3 T G 18: 37,303,239 Y753D probably damaging Het
Pcdhb9 T A 18: 37,403,155 V734E probably damaging Het
Pibf1 T A 14: 99,196,395 L593I probably benign Het
Ppp1r32 A T 19: 10,478,265 F207I probably damaging Het
Prag1 G A 8: 36,147,239 C1315Y probably damaging Het
Prl3c1 T C 13: 27,199,347 S19P probably damaging Het
Ptprz1 A T 6: 23,002,540 D1543V probably damaging Het
Ripor2 A G 13: 24,695,617 N356S probably benign Het
Scrib T C 15: 76,059,188 H914R possibly damaging Het
Sema6b G A 17: 56,128,448 A265V probably damaging Het
Tdrd9 C G 12: 111,985,066 L97V probably benign Het
Trabd T A 15: 89,085,821 L340H probably damaging Het
Trpm1 T C 7: 64,199,269 W88R probably damaging Het
Txndc12 G T 4: 108,853,222 probably null Het
Vmn1r175 T C 7: 23,809,098 I35V probably benign Het
Vmn1r48 A T 6: 90,036,012 V277E probably damaging Het
Vmn2r72 G A 7: 85,751,233 H203Y probably benign Het
Zbtb7c A G 18: 76,137,327 E162G probably benign Het
Zfp93 T A 7: 24,276,460 C623* probably null Het
Zzz3 A G 3: 152,449,648 I645V probably null Het
Other mutations in Dsg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dsg2 APN 18 20601769 missense probably benign 0.10
IGL00979:Dsg2 APN 18 20582767 missense probably damaging 0.99
IGL01081:Dsg2 APN 18 20589942 unclassified probably benign
IGL01358:Dsg2 APN 18 20601793 missense probably damaging 0.98
IGL02002:Dsg2 APN 18 20579176 missense probably damaging 1.00
IGL02263:Dsg2 APN 18 20590020 missense possibly damaging 0.70
IGL02410:Dsg2 APN 18 20602132 missense probably benign 0.04
IGL02553:Dsg2 APN 18 20592410 missense probably damaging 1.00
IGL03036:Dsg2 APN 18 20579077 missense probably damaging 0.99
dissolute UTSW 18 20595951 splice site probably null
Dysjunction UTSW 18 20582939 nonsense probably null
weg UTSW 18 20580651 nonsense probably null
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0112:Dsg2 UTSW 18 20583042 missense probably benign 0.02
R0305:Dsg2 UTSW 18 20582695 splice site probably benign
R0380:Dsg2 UTSW 18 20582939 nonsense probably null
R0401:Dsg2 UTSW 18 20592508 splice site probably benign
R0421:Dsg2 UTSW 18 20579391 missense probably damaging 1.00
R0578:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R0667:Dsg2 UTSW 18 20573499 missense possibly damaging 0.50
R1223:Dsg2 UTSW 18 20573493 missense probably benign 0.23
R1433:Dsg2 UTSW 18 20582723 missense probably damaging 0.98
R1543:Dsg2 UTSW 18 20594211 missense probably benign 0.33
R1730:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1783:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1946:Dsg2 UTSW 18 20580548 missense probably damaging 1.00
R1991:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R1992:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R2027:Dsg2 UTSW 18 20583004 unclassified probably benign
R2109:Dsg2 UTSW 18 20592289 missense probably benign 0.00
R2143:Dsg2 UTSW 18 20579161 missense probably damaging 1.00
R2201:Dsg2 UTSW 18 20596054 missense probably damaging 1.00
R2343:Dsg2 UTSW 18 20602298 missense probably damaging 0.99
R2937:Dsg2 UTSW 18 20579128 missense probably damaging 1.00
R3710:Dsg2 UTSW 18 20602117 missense probably damaging 1.00
R3734:Dsg2 UTSW 18 20601947 missense probably benign 0.41
R3773:Dsg2 UTSW 18 20591862 missense probably damaging 1.00
R4176:Dsg2 UTSW 18 20580663 missense probably benign 0.25
R4213:Dsg2 UTSW 18 20598514 missense probably benign 0.01
R4299:Dsg2 UTSW 18 20595951 splice site probably null
R4515:Dsg2 UTSW 18 20601387 missense probably benign
R4649:Dsg2 UTSW 18 20602245 missense possibly damaging 0.56
R4940:Dsg2 UTSW 18 20579430 missense probably damaging 1.00
R4949:Dsg2 UTSW 18 20590184 missense probably damaging 1.00
R4998:Dsg2 UTSW 18 20601521 missense probably benign 0.26
R5078:Dsg2 UTSW 18 20596083 critical splice donor site probably null
R5155:Dsg2 UTSW 18 20598658 missense possibly damaging 0.67
R5398:Dsg2 UTSW 18 20579133 missense probably benign 0.45
R5503:Dsg2 UTSW 18 20580651 nonsense probably null
R6133:Dsg2 UTSW 18 20590089 missense probably benign 0.00
R6163:Dsg2 UTSW 18 20598669 critical splice donor site probably null
R6226:Dsg2 UTSW 18 20579449 missense probably damaging 0.98
R6228:Dsg2 UTSW 18 20594293 critical splice donor site probably null
R6241:Dsg2 UTSW 18 20590217 splice site probably null
R6482:Dsg2 UTSW 18 20601314 missense possibly damaging 0.69
R6524:Dsg2 UTSW 18 20583036 missense probably damaging 1.00
R6856:Dsg2 UTSW 18 20601802 missense probably damaging 0.98
R7058:Dsg2 UTSW 18 20592275 missense probably benign 0.00
R7108:Dsg2 UTSW 18 20601863 missense probably damaging 1.00
R7149:Dsg2 UTSW 18 20579454 missense probably damaging 0.98
R7207:Dsg2 UTSW 18 20601459 missense probably damaging 0.99
R7256:Dsg2 UTSW 18 20591931 missense possibly damaging 0.96
R7315:Dsg2 UTSW 18 20579160 missense probably damaging 0.97
R7471:Dsg2 UTSW 18 20580618 missense probably benign 0.08
R7558:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R8094:Dsg2 UTSW 18 20583004 unclassified probably benign
R8118:Dsg2 UTSW 18 20582801 missense probably benign 0.11
R8307:Dsg2 UTSW 18 20575064 missense probably benign 0.19
R8308:Dsg2 UTSW 18 20575064 missense probably benign 0.19
Z1176:Dsg2 UTSW 18 20580621 missense probably damaging 1.00
Z1177:Dsg2 UTSW 18 20602249 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGGCATGAATGGTTCTCAG -3'
(R):5'- ATTGGGCAGCACATCCCTAC -3'

Sequencing Primer
(F):5'- AGGATTGCTCTCAGTTCAGCAGAC -3'
(R):5'- TCCTAGAGTTATTCCATGAGTGAG -3'
Posted On2020-06-30