Incidental Mutation 'R7223:Daam1'
ID561962
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Namedishevelled associated activator of morphogenesis 1
Synonyms1700066F09Rik, 2310028E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7223 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location71831078-71992333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71988943 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 971 (F971L)
Ref Sequence ENSEMBL: ENSMUSP00000152564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
Predicted Effect probably damaging
Transcript: ENSMUST00000085299
AA Change: F971L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574
AA Change: F971L

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221317
AA Change: F962L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000223272
AA Change: F971L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,274,143 V733E probably benign Het
Adam34 A T 8: 43,652,004 N201K probably benign Het
Aldh3b2 A C 19: 3,979,592 S322R probably damaging Het
Anpep A T 7: 79,825,310 L914Q probably damaging Het
Arhgap30 T C 1: 171,407,571 F535S probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2a G T 10: 128,112,606 G252V probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Carmil3 T C 14: 55,496,238 F359S possibly damaging Het
Ccdc124 A T 8: 70,868,526 L190Q probably damaging Het
Ccr6 T C 17: 8,256,140 V59A probably damaging Het
Ccr8 T A 9: 120,094,617 I266N probably damaging Het
Cdh23 T A 10: 60,331,817 E1798V probably damaging Het
Cdk5rap2 T C 4: 70,235,447 N1713S probably benign Het
Cep19 T A 16: 32,104,015 I33N probably damaging Het
Cers3 A T 7: 66,783,415 Y196F probably damaging Het
Cidea T C 18: 67,366,421 I126T probably damaging Het
Copg2 A T 6: 30,812,754 Y546* probably null Het
Cul3 A T 1: 80,287,000 V261E probably benign Het
Cyp2g1 A T 7: 26,814,632 D221V probably damaging Het
Cyp8b1 G A 9: 121,915,097 H390Y probably damaging Het
Dnajc24 G A 2: 106,001,966 S24L possibly damaging Het
Dpysl3 T C 18: 43,438,042 S56G probably benign Het
Esp1 A G 17: 40,731,081 D88G probably benign Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fam186b T C 15: 99,279,837 E536G possibly damaging Het
Fbxo3 T C 2: 104,043,012 V156A possibly damaging Het
Gls2 C A 10: 128,199,194 H65Q probably benign Het
Gp2 A G 7: 119,451,498 probably null Het
Gpcpd1 T A 2: 132,534,056 K435I probably benign Het
Gpx6 T A 13: 21,317,670 probably null Het
Hps3 A T 3: 20,030,419 S202T probably benign Het
Htr1d T A 4: 136,443,501 L347H probably damaging Het
Igfals T C 17: 24,881,234 L433P probably damaging Het
Ilvbl C T 10: 78,583,696 H537Y probably benign Het
Iqgap2 A T 13: 95,628,972 M1530K probably damaging Het
Jarid2 A G 13: 44,896,322 T247A possibly damaging Het
L3hypdh C T 12: 72,074,009 V323I possibly damaging Het
Lama3 C T 18: 12,582,608 T1707I possibly damaging Het
Map6 G T 7: 99,268,025 A2S probably damaging Het
Mfap3 T A 11: 57,530,240 I349K probably benign Het
Mybl2 A G 2: 163,072,705 T248A probably benign Het
N6amt1 A G 16: 87,362,660 *151W probably null Het
Nhlrc1 A G 13: 47,014,208 V191A probably benign Het
Nkx2-5 T C 17: 26,839,620 E120G possibly damaging Het
Olfr1066 T A 2: 86,455,867 I135F possibly damaging Het
Olfr1380 T A 11: 49,564,098 M59K probably damaging Het
Olfr582 C A 7: 103,041,632 T46N possibly damaging Het
Olfr890 T C 9: 38,143,753 V201A probably benign Het
Pcdha8 T G 18: 36,993,148 L228V probably benign Het
Pcsk2 A G 2: 143,690,333 T134A possibly damaging Het
Phldb3 G A 7: 24,624,653 R484Q probably benign Het
Pipox A G 11: 77,881,186 S371P probably damaging Het
Plekhg1 T C 10: 3,873,343 S159P Het
Psme4 C T 11: 30,874,226 P1737S probably benign Het
Pygm G A 19: 6,388,863 D328N probably benign Het
Rabgef1 A T 5: 130,190,960 E88V probably benign Het
Rims2 G T 15: 39,437,032 R245L probably benign Het
Slc38a4 T C 15: 97,010,345 I172V probably damaging Het
Slc4a10 T A 2: 62,268,665 Y586N probably damaging Het
Snap91 C T 9: 86,879,557 probably benign Het
Sorcs1 C T 19: 50,190,042 V881I probably benign Het
Spef2 A T 15: 9,601,640 V1512E unknown Het
Sufu T C 19: 46,453,277 I292T possibly damaging Het
Tet1 T C 10: 62,813,671 N87D possibly damaging Het
Tmem108 T C 9: 103,499,534 T239A not run Het
Tmem121 A T 12: 113,188,494 K111* probably null Het
Tpp2 T A 1: 43,968,888 D417E probably damaging Het
Tpr G A 1: 150,439,256 E2025K possibly damaging Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Ttn T C 2: 76,890,981 D6754G probably null Het
Unc13c T A 9: 73,629,191 M1627L probably benign Het
Ush2a A G 1: 188,810,217 I3327V probably benign Het
Vmn1r74 C T 7: 11,846,967 Q65* probably null Het
Wdr18 G A 10: 79,960,368 R69H probably damaging Het
Zbed5 G T 5: 129,900,438 D132Y probably damaging Het
Zfp644 A T 5: 106,637,582 Y366* probably null Het
Zfyve26 T C 12: 79,246,171 N2068S probably damaging Het
Zic2 T C 14: 122,476,091 F139S probably damaging Het
Zmynd11 T C 13: 9,710,162 Q141R probably benign Het
Zrsr1 A G 11: 22,973,388 E54G probably benign Het
Zscan10 G A 17: 23,609,482 D333N probably benign Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0780:Daam1 UTSW 12 71947050 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1510:Daam1 UTSW 12 71977726 missense probably damaging 1.00
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1957:Daam1 UTSW 12 71982755 critical splice donor site probably null
R1974:Daam1 UTSW 12 71988929 missense probably damaging 0.99
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3161:Daam1 UTSW 12 71947098 missense unknown
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4635:Daam1 UTSW 12 71958744 splice site probably null
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5180:Daam1 UTSW 12 71947125 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5358:Daam1 UTSW 12 71952459 nonsense probably null
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6251:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6291:Daam1 UTSW 12 71946251 missense unknown
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7340:Daam1 UTSW 12 71988939 missense probably benign 0.28
R7467:Daam1 UTSW 12 71985806 nonsense probably null
R7709:Daam1 UTSW 12 71977649 missense probably benign 0.10
R7715:Daam1 UTSW 12 71988901 missense probably benign 0.15
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTGGCTGGCTAAGAACCCTC -3'
(R):5'- AGTATCTGTCGTCATGTGGCAC -3'

Sequencing Primer
(F):5'- GCTAAGAACCCTCCGTTGTATTTGAG -3'
(R):5'- GGGAAAGGCCAACCCACTG -3'
Posted On2019-06-26