Incidental Mutation 'R8158:Zcchc4'
ID 633354
Institutional Source Beutler Lab
Gene Symbol Zcchc4
Ensembl Gene ENSMUSG00000029179
Gene Name zinc finger, CCHC domain containing 4
Synonyms 4930449I23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock # R8158 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 52775409-52824665 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52815918 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 375 (Y375H)
Ref Sequence ENSEMBL: ENSMUSP00000031077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031077] [ENSMUST00000113904]
AlphaFold Q8BKW4
Predicted Effect probably damaging
Transcript: ENSMUST00000031077
AA Change: Y375H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031077
Gene: ENSMUSG00000029179
AA Change: Y375H

DomainStartEndE-ValueType
Pfam:zf-GRF 37 81 2.9e-19 PFAM
Pfam:N6-adenineMlase 168 337 5.1e-11 PFAM
ZnF_C2HC 442 458 1.27e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113904
AA Change: Y375H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109537
Gene: ENSMUSG00000029179
AA Change: Y375H

DomainStartEndE-ValueType
Pfam:zf-GRF 37 81 2.4e-17 PFAM
Pfam:N6-adenineMlase 168 338 7.1e-11 PFAM
ZnF_C2HC 442 458 1.27e-2 SMART
low complexity region 464 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,665,056 D46V probably damaging Het
Abl2 T A 1: 156,642,069 S968T probably benign Het
Adcy8 T C 15: 64,783,806 D608G probably benign Het
Adgb C T 10: 10,378,734 V1162M probably benign Het
Agrn A G 4: 156,173,889 V1040A probably benign Het
Amer3 A T 1: 34,587,660 T327S possibly damaging Het
Apaf1 C T 10: 91,059,658 C426Y probably benign Het
Bsn T C 9: 108,110,033 D2840G unknown Het
Camsap1 A T 2: 25,944,428 C406* probably null Het
Cbr2 A T 11: 120,730,297 M158K probably damaging Het
Ccdc105 G C 10: 78,748,675 Q338E probably benign Het
Cgrrf1 T C 14: 46,853,735 S239P probably benign Het
Clnk C A 5: 38,794,911 probably null Het
Csad T C 15: 102,177,762 M445V probably damaging Het
Dnajb7 T A 15: 81,407,399 N246Y probably damaging Het
Dok6 T C 18: 89,473,947 I169V probably benign Het
Hist1h2bm T C 13: 21,722,461 Y122H probably benign Het
Il1f10 T G 2: 24,291,255 I11R possibly damaging Het
Irs1 C T 1: 82,289,533 V321M probably damaging Het
Itga9 T C 9: 118,877,143 F938L probably damaging Het
Kif7 T C 7: 79,704,694 D781G probably damaging Het
Klhl41 A T 2: 69,671,161 N322I probably damaging Het
Krtap31-1 T G 11: 99,908,075 C35G possibly damaging Het
Lsm11 A T 11: 45,933,997 D234E probably benign Het
Med6 T C 12: 81,573,903 K223R probably benign Het
Mfsd4b2 G A 10: 39,922,068 T97I probably benign Het
Mrgpra1 A T 7: 47,335,456 C158* probably null Het
Nr2e1 T C 10: 42,582,885 T8A probably benign Het
Oas2 T C 5: 120,749,773 M1V probably null Het
Olfr1048 T C 2: 86,236,160 Y218C probably damaging Het
Olfr1132 T A 2: 87,634,889 N286I probably damaging Het
Olfr307 T A 7: 86,335,677 I240F probably benign Het
Olfr393 T A 11: 73,847,871 M85L probably benign Het
Olfr60 T C 7: 140,345,249 I247V probably benign Het
Otof C T 5: 30,380,194 G1257D probably benign Het
Phf2 T C 13: 48,817,760 T479A probably benign Het
Pik3c2a T C 7: 116,342,997 N1516S probably benign Het
Qrich1 C A 9: 108,556,037 T622K probably damaging Het
Rasip1 A G 7: 45,632,519 K482R probably damaging Het
Rgl2 T C 17: 33,936,944 F698L probably benign Het
Scarb1 T C 5: 125,303,137 D124G probably benign Het
Sclt1 A G 3: 41,671,482 I350T probably benign Het
Sec23ip T G 7: 128,767,640 V696G probably damaging Het
Serpina1e G T 12: 103,951,095 T105K probably benign Het
Sin3a A G 9: 57,113,544 probably null Het
Slc34a2 A G 5: 53,060,840 T154A probably damaging Het
Slc9a3 T C 13: 74,155,122 L178P probably damaging Het
Smarca2 A C 19: 26,682,048 I913L probably benign Het
Tcea3 G A 4: 136,273,716 probably null Het
Tmcc1 T A 6: 116,043,474 H339L Het
Trpm2 G T 10: 77,947,897 H247Q probably damaging Het
Tyr T A 7: 87,472,516 D356V probably damaging Het
Vmn2r54 A T 7: 12,615,961 C565S probably damaging Het
Vmn2r82 A C 10: 79,377,802 N74T probably benign Het
Zfhx3 T A 8: 108,948,721 D2134E possibly damaging Het
Zfhx4 T A 3: 5,398,950 Y1414* probably null Het
Zfp282 A T 6: 47,890,692 E267D possibly damaging Het
Zfp442 A T 2: 150,409,176 C269S possibly damaging Het
Zp3 T A 5: 135,985,564 S246T probably benign Het
Other mutations in Zcchc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zcchc4 APN 5 52816169 missense probably benign 0.05
IGL00953:Zcchc4 APN 5 52808296 missense probably damaging 1.00
IGL01860:Zcchc4 APN 5 52808356 missense probably damaging 1.00
IGL02248:Zcchc4 APN 5 52796076 missense probably damaging 1.00
IGL02536:Zcchc4 APN 5 52808316 missense probably damaging 1.00
R0060:Zcchc4 UTSW 5 52807078 missense possibly damaging 0.67
R0060:Zcchc4 UTSW 5 52807078 missense possibly damaging 0.67
R0573:Zcchc4 UTSW 5 52795979 missense probably damaging 1.00
R0634:Zcchc4 UTSW 5 52783208 missense probably benign 0.15
R1353:Zcchc4 UTSW 5 52807077 missense probably benign 0.03
R1791:Zcchc4 UTSW 5 52796590 missense probably damaging 1.00
R1854:Zcchc4 UTSW 5 52815826 missense probably damaging 1.00
R2108:Zcchc4 UTSW 5 52796132 missense probably damaging 0.99
R2696:Zcchc4 UTSW 5 52796231 missense probably damaging 1.00
R2991:Zcchc4 UTSW 5 52804438 missense probably damaging 1.00
R3894:Zcchc4 UTSW 5 52784100 missense probably damaging 1.00
R4523:Zcchc4 UTSW 5 52784067 missense probably damaging 1.00
R4672:Zcchc4 UTSW 5 52796605 missense probably benign 0.00
R4772:Zcchc4 UTSW 5 52796207 missense possibly damaging 0.83
R4905:Zcchc4 UTSW 5 52796650 missense probably damaging 1.00
R4954:Zcchc4 UTSW 5 52819217 missense probably damaging 1.00
R5093:Zcchc4 UTSW 5 52796610 missense probably benign 0.38
R5371:Zcchc4 UTSW 5 52785170 missense probably benign 0.19
R5401:Zcchc4 UTSW 5 52807077 missense probably benign 0.03
R5755:Zcchc4 UTSW 5 52816169 missense probably benign 0.00
R6110:Zcchc4 UTSW 5 52796144 missense possibly damaging 0.95
R6244:Zcchc4 UTSW 5 52783161 missense probably benign 0.00
R6465:Zcchc4 UTSW 5 52819276 missense probably benign 0.03
R6906:Zcchc4 UTSW 5 52823634 missense possibly damaging 0.66
R7019:Zcchc4 UTSW 5 52784033 missense probably benign 0.00
R7363:Zcchc4 UTSW 5 52785168 missense possibly damaging 0.88
R7643:Zcchc4 UTSW 5 52808293 missense possibly damaging 0.85
R8097:Zcchc4 UTSW 5 52795991 missense probably benign 0.34
R8372:Zcchc4 UTSW 5 52796164 missense probably damaging 1.00
R8545:Zcchc4 UTSW 5 52819399 intron probably benign
R8755:Zcchc4 UTSW 5 52819382 missense unknown
R9414:Zcchc4 UTSW 5 52796622 missense probably benign 0.00
R9530:Zcchc4 UTSW 5 52796226 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGGTTAAAGGAGCTTAGCGAATG -3'
(R):5'- TGAGCCGCAAGTGTTCATTG -3'

Sequencing Primer
(F):5'- AGGAGCTTAGCGAATGTTGACTC -3'
(R):5'- CCGCAAGTGTTCATTGAGATTCAC -3'
Posted On 2020-06-30