Incidental Mutation 'R7524:Fcgbp'
ID 582849
Institutional Source Beutler Lab
Gene Symbol Fcgbp
Ensembl Gene ENSMUSG00000047730
Gene Name Fc fragment of IgG binding protein
Synonyms A430096B05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7524 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 28071236-28120862 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28102966 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1440 (S1440P)
Ref Sequence ENSEMBL: ENSMUSP00000075945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076648] [ENSMUST00000138392]
AlphaFold E9Q0B5
Predicted Effect probably damaging
Transcript: ENSMUST00000076648
AA Change: S1440P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075945
Gene: ENSMUSG00000047730
AA Change: S1440P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 1.2e-12 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 6.85e-35 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 4.7e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.7e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 5e-12 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138392
AA Change: S1440P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114271
Gene: ENSMUSG00000047730
AA Change: S1440P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 8.4e-13 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 7.99e-36 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 3.3e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.9e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 1e-11 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Meta Mutation Damage Score 0.3996 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,360 C353Y probably damaging Het
Afap1l2 T A 19: 56,918,111 E452V probably damaging Het
AI464131 C A 4: 41,498,779 V284L probably benign Het
Ak6 A G 13: 100,663,907 D45G probably benign Het
Arhgap17 G A 7: 123,306,420 P334L probably damaging Het
Asns G T 6: 7,677,259 probably null Het
Bend7 A G 2: 4,799,980 T424A probably benign Het
Btbd2 C T 10: 80,646,444 E241K probably damaging Het
Commd2 A C 3: 57,650,148 L99W probably damaging Het
Cpne9 A T 6: 113,302,064 D473V probably damaging Het
Cuzd1 A T 7: 131,311,618 F423L probably damaging Het
Cyp2d9 T C 15: 82,455,945 F390L probably damaging Het
Dcaf5 T A 12: 80,376,696 Q234L probably benign Het
Dennd3 T G 15: 73,524,246 Y201* probably null Het
Dnah17 T C 11: 118,121,481 D485G probably benign Het
Dnah5 A T 15: 28,297,066 T1469S possibly damaging Het
Dnah6 T C 6: 73,118,099 D2167G probably damaging Het
Dst T C 1: 34,291,893 V4921A possibly damaging Het
Ephb2 A G 4: 136,659,709 Y736H probably damaging Het
Eri2 C G 7: 119,785,749 V510L probably benign Het
Eya2 G A 2: 165,769,326 probably null Het
Fam208a T A 14: 27,466,203 C869S probably damaging Het
Fastkd5 G T 2: 130,616,128 Q181K probably benign Het
Fkbp9 G A 6: 56,868,740 V354M probably damaging Het
Frmpd1 T A 4: 45,271,181 S304T probably benign Het
Gtf2a2 T A 9: 70,015,347 Y3* probably null Het
Hagh G A 17: 24,861,340 V226I probably benign Het
Hemk1 T A 9: 107,328,285 I293F probably benign Het
Kcna3 A G 3: 107,037,207 E262G probably damaging Het
Kcnt2 A T 1: 140,584,055 T983S probably damaging Het
Klhdc3 A T 17: 46,678,414 H7Q probably damaging Het
Knl1 A T 2: 119,065,979 Q94L probably damaging Het
Krt12 T C 11: 99,419,659 D224G probably damaging Het
Lats1 T A 10: 7,701,978 S289T possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map1a G A 2: 121,289,812 V60M probably damaging Het
Mms22l T A 4: 24,536,138 F536I possibly damaging Het
Ms4a14 T C 19: 11,303,836 T453A unknown Het
Muc3a A C 5: 137,210,563 I151S probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1019 T A 2: 85,841,357 M145L probably benign Het
Olfr1217 T A 2: 89,023,971 I11L probably benign Het
Olfr1233 A G 2: 89,339,877 C142R probably benign Het
Olfr1507 T C 14: 52,490,293 I224V probably damaging Het
Olfr5 T C 7: 6,480,587 N190D probably benign Het
Olfr8 T A 10: 78,955,491 Y95* probably null Het
Pcdhgb4 A T 18: 37,721,608 D352V probably benign Het
Pced1a A G 2: 130,422,028 F235L probably benign Het
Pclo A G 5: 14,678,303 I2392V unknown Het
Pld1 A T 3: 28,024,321 D43V possibly damaging Het
Ppp1r1b C A 11: 98,350,894 A51D possibly damaging Het
Prr23a1 T A 9: 98,842,864 L93H probably damaging Het
Psg20 T C 7: 18,684,659 D61G probably benign Het
Rab40b T A 11: 121,388,052 I31F probably damaging Het
Rasd2 T C 8: 75,222,081 F212L probably benign Het
Rbl2 A G 8: 91,115,193 I1006V probably benign Het
Sema6c A G 3: 95,167,060 E59G probably benign Het
Slc22a2 G T 17: 12,606,057 V269L possibly damaging Het
Slc2a1 C T 4: 119,132,612 P149S probably damaging Het
Smad4 T G 18: 73,675,871 E108D probably damaging Het
Sorbs2 T A 8: 45,795,656 I648K probably benign Het
Suclg1 A T 6: 73,263,841 I118F probably damaging Het
Tet2 A G 3: 133,480,229 I1149T probably benign Het
Tfr2 T A 5: 137,571,489 Y82* probably null Het
Tfr2 G T 5: 137,583,489 V613L probably benign Het
Tg A T 15: 66,696,161 M1305L probably benign Het
Tmem176a A T 6: 48,844,105 M170L probably benign Het
Trim71 T C 9: 114,513,162 N684S probably benign Het
Tspan9 A G 6: 127,965,251 I212T probably benign Het
Ttn A G 2: 76,942,975 V2361A possibly damaging Het
Uqcrc1 C T 9: 108,936,759 T14M possibly damaging Het
Vmn2r11 T C 5: 109,053,982 I219V probably benign Het
Vmn2r76 T C 7: 86,225,369 H800R probably benign Het
Vmn2r76 C T 7: 86,230,166 G309R probably benign Het
Xpc A T 6: 91,499,531 C529S probably benign Het
Zfp455 T A 13: 67,207,624 S254T possibly damaging Het
Zfp746 T C 6: 48,064,889 H301R possibly damaging Het
Zyg11a A T 4: 108,192,074 I490N probably damaging Het
Other mutations in Fcgbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Fcgbp APN 7 28085130 missense probably damaging 1.00
IGL00331:Fcgbp APN 7 28101541 splice site probably benign
IGL00335:Fcgbp APN 7 28086135 missense possibly damaging 0.90
IGL00470:Fcgbp APN 7 28075086 nonsense probably null
IGL00491:Fcgbp APN 7 28093402 missense probably damaging 1.00
IGL00498:Fcgbp APN 7 28091797 missense probably damaging 1.00
IGL01296:Fcgbp APN 7 28089647 missense probably benign 0.15
IGL01582:Fcgbp APN 7 28093642 missense probably benign 0.19
IGL01929:Fcgbp APN 7 28103963 missense probably damaging 1.00
IGL02024:Fcgbp APN 7 28106374 missense probably damaging 1.00
IGL02027:Fcgbp APN 7 28075204 missense probably damaging 1.00
IGL02140:Fcgbp APN 7 28091954 missense probably damaging 1.00
IGL02162:Fcgbp APN 7 28075235 missense probably damaging 1.00
IGL02345:Fcgbp APN 7 28071643 splice site probably benign
IGL02377:Fcgbp APN 7 28106970 missense possibly damaging 0.67
IGL02389:Fcgbp APN 7 28075171 missense probably damaging 1.00
IGL02423:Fcgbp APN 7 28089953 missense probably benign 0.02
IGL02523:Fcgbp APN 7 28104732 missense possibly damaging 0.89
IGL02561:Fcgbp APN 7 28101174 intron probably benign
IGL02631:Fcgbp APN 7 28085298 missense probably damaging 1.00
IGL02716:Fcgbp APN 7 28101434 missense probably damaging 0.98
IGL02836:Fcgbp APN 7 28117358 missense possibly damaging 0.91
IGL02957:Fcgbp APN 7 28091847 nonsense probably null
IGL02971:Fcgbp APN 7 28101473 missense probably damaging 1.00
IGL03284:Fcgbp APN 7 28085432 missense possibly damaging 0.93
IGL03379:Fcgbp APN 7 28089917 missense possibly damaging 0.76
bilge UTSW 7 28117337 missense probably benign 0.00
R6548_fcgbp_365 UTSW 7 28091918 missense probably benign 0.00
swill UTSW 7 28089734 missense probably damaging 1.00
G1citation:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
IGL02796:Fcgbp UTSW 7 28101151 intron probably benign
PIT4486001:Fcgbp UTSW 7 28075273 missense possibly damaging 0.52
R0277:Fcgbp UTSW 7 28085493 critical splice donor site probably null
R0387:Fcgbp UTSW 7 28091454 splice site probably benign
R0586:Fcgbp UTSW 7 28089713 missense probably damaging 1.00
R0981:Fcgbp UTSW 7 28085110 nonsense probably null
R0987:Fcgbp UTSW 7 28094174 missense probably damaging 1.00
R1240:Fcgbp UTSW 7 28120525 missense probably damaging 1.00
R1394:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1395:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1438:Fcgbp UTSW 7 28103733 nonsense probably null
R1474:Fcgbp UTSW 7 28091848 missense probably benign 0.00
R1521:Fcgbp UTSW 7 28075160 missense probably benign 0.00
R1740:Fcgbp UTSW 7 28101249 missense possibly damaging 0.87
R1750:Fcgbp UTSW 7 28093443 nonsense probably null
R1772:Fcgbp UTSW 7 28105175 missense possibly damaging 0.90
R1804:Fcgbp UTSW 7 28086139 missense probably benign
R1808:Fcgbp UTSW 7 28085090 missense probably benign 0.04
R1819:Fcgbp UTSW 7 28085283 missense probably benign 0.00
R1934:Fcgbp UTSW 7 28107093 missense probably damaging 1.00
R1972:Fcgbp UTSW 7 28094192 missense probably benign 0.11
R2051:Fcgbp UTSW 7 28120360 missense probably damaging 0.97
R2072:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2074:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2124:Fcgbp UTSW 7 28092019 missense probably benign 0.03
R2155:Fcgbp UTSW 7 28107203 missense probably benign 0.00
R3015:Fcgbp UTSW 7 28075413 splice site probably benign
R3037:Fcgbp UTSW 7 28102702 missense possibly damaging 0.62
R3151:Fcgbp UTSW 7 28117240 missense probably damaging 1.00
R3176:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3177:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3276:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3277:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3623:Fcgbp UTSW 7 28101276 missense probably damaging 1.00
R3730:Fcgbp UTSW 7 28085457 missense possibly damaging 0.82
R3935:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R3936:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R4041:Fcgbp UTSW 7 28113979 missense probably benign 0.01
R4056:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4057:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4705:Fcgbp UTSW 7 28107296 missense probably benign 0.44
R4708:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4710:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4779:Fcgbp UTSW 7 28094937 missense probably damaging 1.00
R4820:Fcgbp UTSW 7 28113958 missense probably damaging 1.00
R4863:Fcgbp UTSW 7 28086344 missense probably benign 0.33
R4926:Fcgbp UTSW 7 28086235 missense probably damaging 0.99
R4947:Fcgbp UTSW 7 28089812 missense probably benign 0.00
R4979:Fcgbp UTSW 7 28117570 missense probably benign 0.06
R5002:Fcgbp UTSW 7 28086103 splice site probably null
R5219:Fcgbp UTSW 7 28104085 missense probably damaging 1.00
R5241:Fcgbp UTSW 7 28085199 missense probably damaging 1.00
R5301:Fcgbp UTSW 7 28093674 missense possibly damaging 0.93
R5306:Fcgbp UTSW 7 28091818 missense probably damaging 1.00
R5335:Fcgbp UTSW 7 28089734 missense probably damaging 1.00
R5399:Fcgbp UTSW 7 28105055 missense probably benign 0.05
R5418:Fcgbp UTSW 7 28085313 missense probably damaging 1.00
R5527:Fcgbp UTSW 7 28093635 missense probably benign
R5583:Fcgbp UTSW 7 28091579 missense probably damaging 1.00
R5698:Fcgbp UTSW 7 28092022 missense possibly damaging 0.95
R5780:Fcgbp UTSW 7 28085218 missense probably benign 0.02
R5813:Fcgbp UTSW 7 28101494 missense possibly damaging 0.64
R5910:Fcgbp UTSW 7 28085503 splice site probably benign
R5936:Fcgbp UTSW 7 28086692 missense probably damaging 0.98
R5992:Fcgbp UTSW 7 28120534 missense probably benign 0.05
R6091:Fcgbp UTSW 7 28104965 missense possibly damaging 0.90
R6372:Fcgbp UTSW 7 28107008 missense probably damaging 1.00
R6488:Fcgbp UTSW 7 28093538 missense probably damaging 0.96
R6548:Fcgbp UTSW 7 28091918 missense probably benign 0.00
R6553:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6585:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6695:Fcgbp UTSW 7 28086270 nonsense probably null
R6711:Fcgbp UTSW 7 28089673 missense probably damaging 0.99
R6803:Fcgbp UTSW 7 28103212 missense probably benign 0.00
R6822:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
R6907:Fcgbp UTSW 7 28085018 missense probably damaging 1.00
R6912:Fcgbp UTSW 7 28089704 missense probably benign 0.15
R6924:Fcgbp UTSW 7 28093823 missense probably benign
R6943:Fcgbp UTSW 7 28092052 missense probably benign 0.22
R7060:Fcgbp UTSW 7 28091933 missense probably benign 0.20
R7103:Fcgbp UTSW 7 28084962 missense probably benign 0.00
R7208:Fcgbp UTSW 7 28104021 missense probably benign 0.01
R7291:Fcgbp UTSW 7 28101392 missense probably benign 0.00
R7301:Fcgbp UTSW 7 28093436 missense possibly damaging 0.65
R7404:Fcgbp UTSW 7 28101507 missense probably damaging 1.00
R7426:Fcgbp UTSW 7 28086524 missense probably benign 0.00
R7459:Fcgbp UTSW 7 28107285 missense possibly damaging 0.65
R7475:Fcgbp UTSW 7 28102976 missense probably damaging 0.99
R7505:Fcgbp UTSW 7 28089674 missense probably damaging 0.97
R7517:Fcgbp UTSW 7 28085369 missense probably damaging 1.00
R7519:Fcgbp UTSW 7 28086299 missense probably damaging 1.00
R7649:Fcgbp UTSW 7 28091503 missense possibly damaging 0.88
R7782:Fcgbp UTSW 7 28085035 nonsense probably null
R7820:Fcgbp UTSW 7 28120359 missense probably benign 0.01
R7831:Fcgbp UTSW 7 28106979 missense probably damaging 0.98
R7835:Fcgbp UTSW 7 28117207 missense possibly damaging 0.64
R7947:Fcgbp UTSW 7 28104170 critical splice donor site probably null
R8086:Fcgbp UTSW 7 28113964 missense probably damaging 1.00
R8137:Fcgbp UTSW 7 28105071 missense probably damaging 1.00
R8154:Fcgbp UTSW 7 28085082 missense probably benign 0.00
R8169:Fcgbp UTSW 7 28085494 critical splice donor site probably null
R8176:Fcgbp UTSW 7 28091749 missense possibly damaging 0.88
R8193:Fcgbp UTSW 7 28104851 missense probably damaging 1.00
R8313:Fcgbp UTSW 7 28086344 missense probably benign 0.00
R8350:Fcgbp UTSW 7 28094189 missense probably benign 0.02
R8382:Fcgbp UTSW 7 28117337 missense probably benign 0.00
R8393:Fcgbp UTSW 7 28107390 missense probably benign 0.18
R8438:Fcgbp UTSW 7 28089806 missense probably benign 0.25
R8489:Fcgbp UTSW 7 28105010 missense possibly damaging 0.94
R8495:Fcgbp UTSW 7 28086553 missense probably damaging 1.00
R8707:Fcgbp UTSW 7 28120495 missense probably benign 0.01
R8736:Fcgbp UTSW 7 28106196 missense probably benign 0.05
R8816:Fcgbp UTSW 7 28084987 missense probably benign 0.09
R8905:Fcgbp UTSW 7 28086509 missense probably damaging 1.00
R9031:Fcgbp UTSW 7 28091483 missense possibly damaging 0.89
R9063:Fcgbp UTSW 7 28091852 missense probably damaging 1.00
R9180:Fcgbp UTSW 7 28103773 nonsense probably null
R9262:Fcgbp UTSW 7 28120527 missense probably damaging 1.00
R9439:Fcgbp UTSW 7 28104011 missense possibly damaging 0.60
RF002:Fcgbp UTSW 7 28089755 missense probably benign
X0028:Fcgbp UTSW 7 28104020 missense possibly damaging 0.48
Z1186:Fcgbp UTSW 7 28086191 missense probably benign
Z1186:Fcgbp UTSW 7 28089755 missense probably benign
Z1186:Fcgbp UTSW 7 28091647 missense probably benign
Z1186:Fcgbp UTSW 7 28093345 missense probably benign
Z1186:Fcgbp UTSW 7 28103884 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTTGGGCTTCAGGTCACCTAC -3'
(R):5'- GCACAGTATGTCTTTGCTGCC -3'

Sequencing Primer
(F):5'- TCACCTACGACTGGAACTGGAG -3'
(R):5'- AGTATGTCTTTGCTGCCCCCAC -3'
Posted On 2019-10-17