Incidental Mutation 'BB011:Adgre5'
ID642643
Institutional Source Beutler Lab
Gene Symbol Adgre5
Ensembl Gene ENSMUSG00000002885
Gene Nameadhesion G protein-coupled receptor E5
SynonymsCd97, EGF-TM7 receptor
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #BB011
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location83723251-83741326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83729400 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 256 (P256S)
Ref Sequence ENSEMBL: ENSMUSP00000075240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002964] [ENSMUST00000075843] [ENSMUST00000109802] [ENSMUST00000149368] [ENSMUST00000166939] [ENSMUST00000172396] [ENSMUST00000212949]
Predicted Effect probably benign
Transcript: ENSMUST00000002964
AA Change: P162S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002964
Gene: ENSMUSG00000002885
AA Change: P162S

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 167 1.78e-11 SMART
GPS 384 430 2.18e-8 SMART
Pfam:Dicty_CAR 431 703 1.3e-8 PFAM
Pfam:7tm_2 432 672 8.1e-68 PFAM
low complexity region 704 714 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075843
AA Change: P256S

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075240
Gene: ENSMUSG00000002885
AA Change: P256S

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 165 213 1.38e-8 SMART
EGF_CA 214 261 1.78e-11 SMART
GPS 478 524 2.18e-8 SMART
Pfam:Dicty_CAR 525 798 4.6e-8 PFAM
Pfam:7tm_2 526 766 5.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109802
AA Change: P211S

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105427
Gene: ENSMUSG00000002885
AA Change: P211S

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 168 1.38e-8 SMART
EGF_CA 169 216 1.78e-11 SMART
GPS 433 479 2.18e-8 SMART
Pfam:Dicty_CAR 480 752 5.3e-8 PFAM
Pfam:7tm_2 481 721 7.5e-67 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149368
Predicted Effect probably damaging
Transcript: ENSMUST00000166939
AA Change: P160S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128220
Gene: ENSMUSG00000002885
AA Change: P160S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 28 66 1.63e1 SMART
EGF_CA 67 117 5.92e-8 SMART
EGF_CA 118 165 1.78e-11 SMART
GPS 382 428 2.18e-8 SMART
Pfam:Dicty_CAR 429 701 2.1e-7 PFAM
Pfam:7tm_2 430 670 1.7e-66 PFAM
low complexity region 702 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172396
SMART Domains Protein: ENSMUSP00000132222
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212949
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EGF-TM7 subfamily of adhesion G protein-coupled receptors, which mediate cell-cell interactions. These proteins are cleaved by self-catalytic proteolysis into a large extracellular subunit and seven-span transmembrane subunit, which associate at the cell surface as a receptor complex. The encoded protein may play a role in cell adhesion as well as leukocyte recruitment, activation and migration, and contains multiple extracellular EGF-like repeats which mediate binding to chondroitin sulfate and the cell surface complement regulatory protein CD55. Expression of this gene may play a role in the progression of several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms with 3 to 5 EGF-like repeats have been observed for this gene. This gene is found in a cluster with other EGF-TM7 genes on the short arm of chromosome 19. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype apart from mild granulocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Adgre5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Adgre5 APN 8 83728401 missense probably benign 0.01
IGL01365:Adgre5 APN 8 83723889 splice site probably null
IGL01661:Adgre5 APN 8 83727935 missense probably damaging 0.99
IGL01707:Adgre5 APN 8 83724347 missense probably damaging 1.00
IGL01760:Adgre5 APN 8 83731957 missense probably benign 0.02
IGL02207:Adgre5 APN 8 83728284 missense probably damaging 1.00
IGL02483:Adgre5 APN 8 83725253 missense probably damaging 1.00
IGL03194:Adgre5 APN 8 83734018 missense possibly damaging 0.67
BB001:Adgre5 UTSW 8 83729400 missense possibly damaging 0.85
PIT4453001:Adgre5 UTSW 8 83724460 missense probably benign 0.08
R0024:Adgre5 UTSW 8 83728284 missense probably damaging 1.00
R0137:Adgre5 UTSW 8 83724898 missense probably damaging 1.00
R0257:Adgre5 UTSW 8 83731995 missense possibly damaging 0.54
R0485:Adgre5 UTSW 8 83731998 missense probably damaging 0.99
R0522:Adgre5 UTSW 8 83730176 missense probably benign 0.30
R0940:Adgre5 UTSW 8 83733497 missense probably damaging 1.00
R1372:Adgre5 UTSW 8 83728320 missense probably damaging 0.96
R1617:Adgre5 UTSW 8 83730177 missense possibly damaging 0.50
R1679:Adgre5 UTSW 8 83729405 missense probably benign 0.09
R1917:Adgre5 UTSW 8 83729109 missense probably damaging 0.99
R1918:Adgre5 UTSW 8 83729109 missense probably damaging 0.99
R2072:Adgre5 UTSW 8 83727804 missense probably benign 0.24
R2831:Adgre5 UTSW 8 83728394 missense possibly damaging 0.80
R5250:Adgre5 UTSW 8 83733440 missense probably benign
R5512:Adgre5 UTSW 8 83729086 missense probably benign
R6077:Adgre5 UTSW 8 83727966 missense probably benign
R7486:Adgre5 UTSW 8 83723886 missense probably damaging 1.00
R7733:Adgre5 UTSW 8 83729396 missense probably benign 0.06
R7924:Adgre5 UTSW 8 83729400 missense possibly damaging 0.85
R8388:Adgre5 UTSW 8 83730186 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCCTGGTATTCACTGGC -3'
(R):5'- TCCTGTACCACTGAATGAGGCC -3'

Sequencing Primer
(F):5'- TGGCTACTCACCTGACTGTGG -3'
(R):5'- TACCTCAGGCCAGAGACTGTAG -3'
Posted On2020-08-01