Incidental Mutation 'R5892:Plekha6'
ID457224
Institutional Source Beutler Lab
Gene Symbol Plekha6
Ensembl Gene ENSMUSG00000041757
Gene Namepleckstrin homology domain containing, family A member 6
SynonymsPepp3
MMRRC Submission 044093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5892 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location133164210-133303435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 133272307 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 208 (R208P)
Ref Sequence ENSEMBL: ENSMUSP00000048214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038295] [ENSMUST00000105082] [ENSMUST00000186917] [ENSMUST00000187285] [ENSMUST00000212252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038295
AA Change: R208P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048214
Gene: ENSMUSG00000041757
AA Change: R208P

DomainStartEndE-ValueType
PH 60 160 2.23e-20 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
Blast:PH 506 576 6e-31 BLAST
coiled coil region 613 686 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105082
AA Change: R228P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100703
Gene: ENSMUSG00000041757
AA Change: R228P

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186917
AA Change: R228P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139794
Gene: ENSMUSG00000041757
AA Change: R228P

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187285
AA Change: R208P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140558
Gene: ENSMUSG00000041757
AA Change: R208P

DomainStartEndE-ValueType
PH 60 160 9.6e-23 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
coiled coil region 539 612 N/A INTRINSIC
low complexity region 687 708 N/A INTRINSIC
low complexity region 1014 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187299
Predicted Effect probably benign
Transcript: ENSMUST00000189598
Predicted Effect unknown
Transcript: ENSMUST00000190186
AA Change: R30P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212142
Predicted Effect probably benign
Transcript: ENSMUST00000212252
Meta Mutation Damage Score 0.0950 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Alms1 T A 6: 85,620,903 S904T probably damaging Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Dclre1a T C 19: 56,547,140 E4G probably benign Het
Depdc1a G C 3: 159,526,669 A686P probably damaging Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fam107b A G 2: 3,778,564 E268G probably damaging Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gzmk C T 13: 113,173,922 probably null Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrfn5 A G 12: 61,843,418 T498A probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Mfsd1 A G 3: 67,589,829 probably null Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Pde8a A G 7: 81,295,691 N183S probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tmtc2 C T 10: 105,413,505 M122I probably benign Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Unc93b1 A T 19: 3,943,632 D358V probably damaging Het
Vrk2 A T 11: 26,534,372 probably benign Het
Wdr24 A T 17: 25,827,986 Q671L probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Plekha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Plekha6 APN 1 133282165 missense possibly damaging 0.92
IGL01328:Plekha6 APN 1 133272336 unclassified probably null
IGL01739:Plekha6 APN 1 133260131 missense probably benign 0.38
IGL01803:Plekha6 APN 1 133272414 nonsense probably null
IGL02053:Plekha6 APN 1 133272492 missense probably damaging 1.00
IGL02269:Plekha6 APN 1 133287849 missense possibly damaging 0.82
IGL02276:Plekha6 APN 1 133293861 missense possibly damaging 0.93
IGL02478:Plekha6 APN 1 133283293 missense probably benign 0.03
IGL02754:Plekha6 APN 1 133284938 missense probably damaging 0.98
R0100:Plekha6 UTSW 1 133270177 missense probably damaging 0.99
R0334:Plekha6 UTSW 1 133282180 missense probably benign 0.24
R0470:Plekha6 UTSW 1 133272307 missense probably benign 0.07
R1016:Plekha6 UTSW 1 133260094 missense probably benign 0.00
R1254:Plekha6 UTSW 1 133272589 missense probably benign 0.10
R1728:Plekha6 UTSW 1 133287846 missense probably benign
R1729:Plekha6 UTSW 1 133287846 missense probably benign
R1730:Plekha6 UTSW 1 133287846 missense probably benign
R1739:Plekha6 UTSW 1 133287846 missense probably benign
R1762:Plekha6 UTSW 1 133287846 missense probably benign
R1771:Plekha6 UTSW 1 133273913 missense probably benign 0.00
R1783:Plekha6 UTSW 1 133287846 missense probably benign
R1784:Plekha6 UTSW 1 133287846 missense probably benign
R1785:Plekha6 UTSW 1 133287846 missense probably benign
R1786:Plekha6 UTSW 1 133279365 intron probably null
R1997:Plekha6 UTSW 1 133263818 missense probably benign 0.43
R2020:Plekha6 UTSW 1 133284970 missense possibly damaging 0.55
R2130:Plekha6 UTSW 1 133279365 intron probably null
R2131:Plekha6 UTSW 1 133279365 intron probably null
R2133:Plekha6 UTSW 1 133279365 intron probably null
R2992:Plekha6 UTSW 1 133294658 missense probably damaging 1.00
R3781:Plekha6 UTSW 1 133294655 missense probably damaging 1.00
R3810:Plekha6 UTSW 1 133273979 missense probably benign
R4067:Plekha6 UTSW 1 133294678 missense probably benign 0.40
R4725:Plekha6 UTSW 1 133283320 missense probably damaging 1.00
R5657:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5658:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5746:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5768:Plekha6 UTSW 1 133280378 missense probably benign 0.01
R5785:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5937:Plekha6 UTSW 1 133260101 missense possibly damaging 0.89
R5985:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5986:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6053:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6072:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6167:Plekha6 UTSW 1 133279407 missense probably null 0.96
R6843:Plekha6 UTSW 1 133274878 missense probably damaging 1.00
R6879:Plekha6 UTSW 1 133260055 missense possibly damaging 0.95
R6912:Plekha6 UTSW 1 133272535 missense probably benign 0.02
R6970:Plekha6 UTSW 1 133263818 missense probably benign 0.43
R7041:Plekha6 UTSW 1 133272460 missense possibly damaging 0.93
R7248:Plekha6 UTSW 1 133275848 nonsense probably null
R7400:Plekha6 UTSW 1 133274024 nonsense probably null
R7720:Plekha6 UTSW 1 133293707 missense probably damaging 1.00
R7772:Plekha6 UTSW 1 133170022 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- CTGCCCCAGTTACATCACTG -3'
(R):5'- GAGCTATACTGCCAGCCATTG -3'

Sequencing Primer
(F):5'- AGTTACATCACTGCCTCTCTG -3'
(R):5'- CCATTGGGCTGAGCAGG -3'
Posted On2017-02-15