Incidental Mutation 'R8770:Dscam'
ID 664376
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene Name DS cell adhesion molecule
Synonyms 4932410A21Rik
MMRRC Submission
Accession Numbers

Genbank: NM_031174; MGI: 1196281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8770 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 96592079-97170752 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96654906 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1274 (E1274G)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
AlphaFold Q9ERC8
Predicted Effect possibly damaging
Transcript: ENSMUST00000056102
AA Change: E1274G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: E1274G

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (66/67)
MGI Phenotype Strain: 4830358; 3840666;5305025;3761008
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,883,937 probably null Het
Aox2 A T 1: 58,339,604 K1004M probably benign Het
Atn1 C T 6: 124,745,638 probably null Het
Atp8b4 T C 2: 126,342,995 Y916C probably damaging Het
BC030867 A G 11: 102,255,150 N84S probably benign Het
Bicd1 T C 6: 149,518,950 L766S probably damaging Het
Bmpr2 T G 1: 59,845,525 D223E probably benign Het
Bpifc T G 10: 85,965,265 R406S probably damaging Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cdcp1 A T 9: 123,177,861 I607N possibly damaging Het
Cdyl2 T C 8: 116,595,083 Y235C probably damaging Het
Clns1a A G 7: 97,713,910 Q163R probably benign Het
Cntn3 T A 6: 102,277,316 M222L possibly damaging Het
Cpn1 A G 19: 43,963,769 V358A probably damaging Het
Dchs1 G A 7: 105,771,738 R492W probably damaging Het
Dmxl2 T C 9: 54,404,014 T1808A probably benign Het
Dnah10 A G 5: 124,775,346 I1880V possibly damaging Het
Dtwd1 A G 2: 126,154,807 T71A probably damaging Het
Dusp4 T A 8: 34,807,784 M19K probably benign Het
Fam46a A G 9: 85,326,750 Y7H probably benign Het
Fbxo39 T C 11: 72,318,459 F382L probably damaging Het
Fbxw20 A T 9: 109,217,528 C455S probably benign Het
Fcmr T A 1: 130,876,062 V201E probably benign Het
Galnt2 C T 8: 124,334,286 R306* probably null Het
Gpr156 A G 16: 38,004,612 E397G possibly damaging Het
Gzmf A T 14: 56,206,494 V73D probably damaging Het
Laptm4b T C 15: 34,258,697 V39A possibly damaging Het
Mlf2 C A 6: 124,934,296 H91Q probably benign Het
Mylk3 T A 8: 85,364,831 E115V probably damaging Het
Myo6 A G 9: 80,264,199 E494G unknown Het
Myo7b C T 18: 31,981,071 D1076N probably benign Het
Neurl1b A G 17: 26,431,913 D53G probably damaging Het
Noc4l A G 5: 110,648,892 L508P possibly damaging Het
Nup210l C A 3: 90,118,543 F157L probably damaging Het
Ogdh T C 11: 6,355,336 Y959H probably damaging Het
Olfr1246 A G 2: 89,590,827 M96T probably benign Het
Olfr159 T G 4: 43,770,813 N66T probably damaging Het
Pik3ap1 A G 19: 41,328,160 Y264H possibly damaging Het
Plb1 T C 5: 32,247,509 Y4H unknown Het
Rad21 A G 15: 51,968,353 I444T probably benign Het
Recql5 T C 11: 115,897,117 I459V probably benign Het
Scaf1 T C 7: 45,006,705 T917A unknown Het
Sdc4 C T 2: 164,428,902 V146I probably damaging Het
Serpina6 T C 12: 103,653,939 S184G probably benign Het
Shkbp1 C A 7: 27,351,886 R218S possibly damaging Het
Slc17a3 A G 13: 23,855,624 D255G Het
Slc7a2 T G 8: 40,899,230 V110G probably damaging Het
Slf1 A C 13: 77,046,647 V853G probably damaging Het
Smarcad1 T C 6: 65,052,734 V102A probably benign Het
Sobp T C 10: 43,160,792 K50R probably damaging Het
Spink10 A T 18: 62,653,461 R47S probably benign Het
Sspo T A 6: 48,474,272 F2720Y probably null Het
Tdrkh T A 3: 94,429,133 V459D probably damaging Het
Tlcd2 T A 11: 75,469,804 D224E probably damaging Het
Tln2 T A 9: 67,323,022 Q87L probably benign Het
Tmem131 A T 1: 36,799,105 probably benign Het
Tmem63a G A 1: 180,962,396 G378R probably benign Het
Trank1 C A 9: 111,390,824 Q2210K probably benign Het
Trim24 T A 6: 37,957,500 probably benign Het
Trim37 T A 11: 87,159,849 I238N probably damaging Het
Vps39 A T 2: 120,323,067 D675E probably benign Het
Wdr63 T C 3: 146,046,543 T793A probably benign Het
Zfp229 T A 17: 21,745,814 C342S probably damaging Het
Zfp759 A G 13: 67,140,353 H656R probably damaging Het
Zfp994 T C 17: 22,200,999 Y323C probably damaging Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96608065 missense possibly damaging 0.64
IGL00841:Dscam APN 16 96819877 missense probably damaging 1.00
IGL01289:Dscam APN 16 96643882 nonsense probably null
IGL01358:Dscam APN 16 96610343 missense possibly damaging 0.68
IGL01431:Dscam APN 16 96652078 critical splice donor site probably null
IGL01444:Dscam APN 16 96673709 missense possibly damaging 0.95
IGL01767:Dscam APN 16 96654936 missense probably damaging 1.00
IGL01866:Dscam APN 16 96685350 missense probably benign 0.06
IGL02020:Dscam APN 16 96716069 missense probably damaging 1.00
IGL02023:Dscam APN 16 96801197 missense probably benign 0.06
IGL02057:Dscam APN 16 96716073 nonsense probably null
IGL02389:Dscam APN 16 96640897 missense probably benign 0.27
IGL02409:Dscam APN 16 96819888 missense possibly damaging 0.46
IGL02694:Dscam APN 16 96593276 missense probably benign 0.00
IGL02899:Dscam APN 16 96709247 missense probably damaging 0.98
IGL02956:Dscam APN 16 96801272 missense probably damaging 0.98
IGL03035:Dscam APN 16 96819970 missense possibly damaging 0.94
IGL03191:Dscam APN 16 96820769 missense probably benign 0.36
growler UTSW 16 96820997 missense probably damaging 0.99
Twostep UTSW 16 96825782 splice site probably null
F6893:Dscam UTSW 16 97056460 missense possibly damaging 0.78
K3955:Dscam UTSW 16 96673687 missense probably benign 0.00
R0024:Dscam UTSW 16 96593385 nonsense probably null
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0117:Dscam UTSW 16 96673678 missense probably benign 0.33
R0211:Dscam UTSW 16 96716079 missense possibly damaging 0.50
R0280:Dscam UTSW 16 97039006 missense possibly damaging 0.62
R0355:Dscam UTSW 16 96654905 missense probably benign 0.00
R0380:Dscam UTSW 16 97056610 missense probably damaging 1.00
R0445:Dscam UTSW 16 96772503 missense probably damaging 1.00
R0492:Dscam UTSW 16 96825782 splice site probably null
R0534:Dscam UTSW 16 96652172 missense possibly damaging 0.67
R0593:Dscam UTSW 16 96772408 missense probably benign 0.19
R0707:Dscam UTSW 16 96825782 splice site probably null
R0738:Dscam UTSW 16 96819781 missense possibly damaging 0.48
R1017:Dscam UTSW 16 96833433 missense probably damaging 1.00
R1377:Dscam UTSW 16 96772494 missense probably damaging 1.00
R1440:Dscam UTSW 16 96819951 missense probably damaging 1.00
R1442:Dscam UTSW 16 96608074 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1478:Dscam UTSW 16 96790910 missense probably benign 0.15
R1530:Dscam UTSW 16 96819874 missense probably damaging 1.00
R1731:Dscam UTSW 16 96819876 missense probably damaging 1.00
R1765:Dscam UTSW 16 96685379 missense probably benign 0.00
R1824:Dscam UTSW 16 96825581 missense probably benign 0.00
R1933:Dscam UTSW 16 96593214 missense probably benign 0.00
R2005:Dscam UTSW 16 97038920 missense probably benign 0.02
R2006:Dscam UTSW 16 96819912 missense probably damaging 1.00
R2101:Dscam UTSW 16 96610349 missense probably benign 0.00
R2177:Dscam UTSW 16 96610324 missense probably damaging 0.98
R2342:Dscam UTSW 16 96619502 missense probably damaging 1.00
R2851:Dscam UTSW 16 96622715 missense possibly damaging 0.94
R2929:Dscam UTSW 16 96685412 missense possibly damaging 0.76
R3055:Dscam UTSW 16 96801355 missense probably damaging 1.00
R3157:Dscam UTSW 16 96678510 missense probably benign 0.16
R3159:Dscam UTSW 16 96678510 missense probably benign 0.16
R3944:Dscam UTSW 16 96820997 missense probably damaging 0.99
R4080:Dscam UTSW 16 96683772 missense probably benign 0.01
R4285:Dscam UTSW 16 96709109 critical splice donor site probably null
R4384:Dscam UTSW 16 96709216 missense probably damaging 0.99
R4460:Dscam UTSW 16 96610319 missense probably damaging 1.00
R4575:Dscam UTSW 16 96825623 missense possibly damaging 0.82
R4594:Dscam UTSW 16 96717996 missense possibly damaging 0.78
R4643:Dscam UTSW 16 96685301 missense probably damaging 0.96
R4698:Dscam UTSW 16 96610324 missense probably damaging 1.00
R4716:Dscam UTSW 16 96619571 missense possibly damaging 0.80
R4743:Dscam UTSW 16 96830056 missense probably benign 0.00
R4766:Dscam UTSW 16 96643988 missense probably benign 0.02
R4899:Dscam UTSW 16 96683818 missense probably benign 0.01
R4987:Dscam UTSW 16 96697521 missense probably benign 0.00
R4990:Dscam UTSW 16 96825515 missense probably benign 0.12
R5123:Dscam UTSW 16 96772437 missense probably damaging 1.00
R5130:Dscam UTSW 16 96819779 missense probably benign 0.00
R5328:Dscam UTSW 16 96673678 missense probably benign 0.33
R5666:Dscam UTSW 16 96718164 missense probably benign 0.23
R5670:Dscam UTSW 16 96718164 missense probably benign 0.23
R5678:Dscam UTSW 16 96790900 missense probably benign 0.16
R5827:Dscam UTSW 16 96649991 critical splice donor site probably null
R5907:Dscam UTSW 16 96820920 missense probably damaging 0.97
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6103:Dscam UTSW 16 96825581 missense probably benign
R6240:Dscam UTSW 16 96619502 missense probably damaging 1.00
R6257:Dscam UTSW 16 96673714 missense possibly damaging 0.94
R6361:Dscam UTSW 16 96622811 missense probably benign 0.08
R6405:Dscam UTSW 16 96678425 missense probably damaging 1.00
R6444:Dscam UTSW 16 96619644 missense probably damaging 1.00
R6560:Dscam UTSW 16 96825735 missense probably benign 0.00
R6598:Dscam UTSW 16 96819784 missense probably damaging 1.00
R6622:Dscam UTSW 16 96645073 missense probably benign 0.06
R6792:Dscam UTSW 16 96593255 missense probably damaging 0.96
R6792:Dscam UTSW 16 96648237 missense probably damaging 1.00
R6827:Dscam UTSW 16 97038991 missense probably damaging 1.00
R6868:Dscam UTSW 16 96829940 missense probably damaging 1.00
R6898:Dscam UTSW 16 96829900 missense probably benign 0.02
R6903:Dscam UTSW 16 96820788 missense probably damaging 1.00
R7051:Dscam UTSW 16 96819786 missense probably benign 0.01
R7146:Dscam UTSW 16 96829917 nonsense probably null
R7180:Dscam UTSW 16 96825564 missense probably damaging 0.97
R7209:Dscam UTSW 16 96650344 splice site probably null
R7247:Dscam UTSW 16 96820808 missense probably damaging 0.99
R7269:Dscam UTSW 16 96678401 missense probably benign 0.00
R7301:Dscam UTSW 16 97056532 missense probably benign 0.01
R7328:Dscam UTSW 16 96645035 nonsense probably null
R7368:Dscam UTSW 16 96643931 missense probably benign 0.00
R7425:Dscam UTSW 16 96629398 missense probably damaging 1.00
R7474:Dscam UTSW 16 96819889 missense possibly damaging 0.88
R7536:Dscam UTSW 16 96641026 splice site probably null
R7624:Dscam UTSW 16 96610324 missense probably damaging 1.00
R7766:Dscam UTSW 16 96790901 missense probably benign 0.31
R7817:Dscam UTSW 16 96640864 missense probably benign
R7843:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7911:Dscam UTSW 16 96643922 missense probably benign 0.01
R8108:Dscam UTSW 16 96643879 missense probably benign 0.01
R8128:Dscam UTSW 16 96801174 splice site probably null
R8876:Dscam UTSW 16 96619628 missense probably damaging 0.96
R9005:Dscam UTSW 16 96801380 missense probably damaging 1.00
R9009:Dscam UTSW 16 97038916 missense probably benign 0.10
R9168:Dscam UTSW 16 96619568 missense possibly damaging 0.82
R9176:Dscam UTSW 16 96685353 missense probably benign 0.37
R9244:Dscam UTSW 16 96685229 missense possibly damaging 0.62
R9339:Dscam UTSW 16 96716063 missense possibly damaging 0.89
R9374:Dscam UTSW 16 97056657 missense probably benign 0.19
R9385:Dscam UTSW 16 97039003 missense probably benign
R9674:Dscam UTSW 16 96640836 missense probably benign 0.03
X0025:Dscam UTSW 16 96709161 missense probably damaging 1.00
Z1088:Dscam UTSW 16 96772561 missense probably benign 0.01
Z1177:Dscam UTSW 16 96608189 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTTAGCAGTGTAGCCATCAGC -3'
(R):5'- AGTGCCACTTGCTTCTGTGG -3'

Sequencing Primer
(F):5'- TTAGTACTGCACTCACCACTAGGG -3'
(R):5'- GGTGATGAAATGTTTCTCTCTCTTC -3'
Posted On 2021-03-08