Mutagenetix > Incidental Mutation

Incidental Mutation 'R8977:Top2b'

683529

Institutional Source

Beutler Lab

Gene Symbol

Top2b

Ensembl Gene

ENSMUSG00000017485

Gene Name

topoisomerase (DNA) II beta

Synonyms

D230016L12Rik, Top-2

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.931) question?

Stock #

R8977 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

16365179-16435462 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 16393239 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 299 (H299Q)

Ref Sequence

ENSEMBL: ENSMUSP00000017629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017629]

AlphaFold

Q64511

Predicted Effect

probably benign
Transcript: ENSMUST00000017629
AA Change: H299Q

PolyPhen 2 Score 0.359 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: H299Q

Domain	Start	End	E-Value	Type
Blast:TOP2c	32	70	7e-10	BLAST
HATPase_c	85	234	1.91e-2	SMART
TOP2c	89	679	N/A	SMART
TOP4c	702	1175	2.55e-230	SMART
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1287	1299	N/A	INTRINSIC
low complexity region	1324	1336	N/A	INTRINSIC
low complexity region	1360	1382	N/A	INTRINSIC
Pfam:DTHCT	1495	1597	4.6e-31	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	A	6: 149,328,408	I984N	probably damaging	Het
4930438A08Rik	A	G	11: 58,293,884	E476G	unknown	Het
Aars	G	A	8: 111,040,217	R77Q	probably damaging	Het
Abcc10	C	A	17: 46,313,667	V795L	probably benign	Het
Adam30	A	G	3: 98,162,062	K276E	probably damaging	Het
Adam6b	A	T	12: 113,490,376	N271I	probably benign	Het
Adgrl2	T	C	3: 148,954,587	I17V	probably null	Het
Anapc1	C	A	2: 128,641,402	G1258C	probably damaging	Het
Ank2	G	T	3: 126,944,926	H2436Q	unknown	Het
Ankrd13a	A	T	5: 114,795,745	K267*	probably null	Het
Apob	T	C	12: 8,015,990	Y4320H	probably damaging	Het
Atp2b2	T	C	6: 113,773,364	D678G	probably damaging	Het
Bhlhe41	C	A	6: 145,863,370	V239F	possibly damaging	Het
Cbfa2t2	T	G	2: 154,500,490	L42R	probably benign	Het
Ccdc173	T	C	2: 69,787,299	H46R	possibly damaging	Het
Ccer2	G	A	7: 28,756,688	V52M	probably damaging	Het
Ccnj	T	C	19: 40,844,939	F187S	probably damaging	Het
Cd109	G	A	9: 78,707,528	V1286I	probably benign	Het
Cfap46	G	T	7: 139,679,933	T148N	probably benign	Het
Chmp7	A	G	14: 69,721,235	V210A	probably benign	Het
Cuzd1	A	G	7: 131,322,025	F8S	probably benign	Het
Dnmbp	A	T	19: 43,852,312	D549E	probably damaging	Het
Dpp4	A	G	2: 62,374,403	L240P	probably benign	Het
Dst	A	T	1: 34,247,783	R3398S	probably damaging	Het
Eml6	A	G	11: 29,784,182	I1186T	possibly damaging	Het
Extl1	T	C	4: 134,359,124	E540G	possibly damaging	Het
Gdpd5	A	G	7: 99,453,850	I339V	probably benign	Het
Ggcx	T	C	6: 72,429,282		probably null	Het
Gm9195	A	G	14: 72,453,898	F1637L	unknown	Het
Igkv5-48	G	C	6: 69,726,632	N96K	possibly damaging	Het
Itga11	T	C	9: 62,755,640	I546T	probably damaging	Het
Map3k5	T	A	10: 20,079,254	F624L	possibly damaging	Het
Map7	T	A	10: 20,269,590		probably null	Het
Mdga2	A	T	12: 66,797,635	D196E	possibly damaging	Het
Mettl2	T	C	11: 105,128,965	C143R	probably benign	Het
Mut	G	T	17: 40,938,590	R152L	probably benign	Het
Ncam1	G	T	9: 49,507,525	T825K	probably damaging	Het
Nucb2	C	A	7: 116,528,828	N257K	probably benign	Het
Olfr1085	C	T	2: 86,658,128	C110Y	probably benign	Het
Olfr1535	T	A	13: 21,555,846	M59L	possibly damaging	Het
Olfr378	A	G	11: 73,425,825	S53P	probably benign	Het
Olfr406	A	T	11: 74,269,478	I30F	probably benign	Het
Olfr640	A	T	7: 104,021,555	Y254*	probably null	Het
Olfr664	A	T	7: 104,734,041	F108I	probably damaging	Het
Pamr1	T	A	2: 102,611,618	V184D	probably damaging	Het
Paqr9	A	T	9: 95,560,835	I293F	possibly damaging	Het
Pi15	G	T	1: 17,619,902		probably null	Het
Pkm	T	A	9: 59,671,640	I301N	probably damaging	Het
Pramel1	T	A	4: 143,397,391	I212N	probably benign	Het
Prdm6	A	T	18: 53,568,301	I549F	probably damaging	Het
Prpf8	A	G	11: 75,496,044	E1105G	probably benign	Het
Rad51b	T	A	12: 79,657,888	V274E	probably damaging	Het
Rd3l	T	A	12: 111,980,159	Y61F	probably damaging	Het
Rgs11	T	C	17: 26,208,259	V388A	probably damaging	Het
Rictor	A	G	15: 6,783,085	I901V	probably benign	Het
Riox2	A	G	16: 59,491,832	D444G	probably benign	Het
Scn2a	T	A	2: 65,763,670	V1621E	probably damaging	Het
Sec11c	A	G	18: 65,812,747	I94V	possibly damaging	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Slc34a1	T	C	13: 55,409,002	I337T	probably benign	Het
Slc6a19	T	C	13: 73,682,150	K516E	probably benign	Het
Slco1b2	A	T	6: 141,683,254	M596L	probably benign	Het
Smarce1	A	G	11: 99,219,685	I100T	possibly damaging	Het
Stk32c	A	T	7: 139,125,245	M119K	possibly damaging	Het
Tekt2	T	C	4: 126,323,473		probably null	Het
Tenm4	A	T	7: 96,811,970	N908Y	probably damaging	Het
Tex38	A	G	4: 115,780,595	S4P	probably benign	Het
Trim55	C	A	3: 19,659,177	R131S	probably benign	Het
Vmn2r109	A	T	17: 20,554,269	Y275N	possibly damaging	Het
Vmn2r116	C	T	17: 23,386,942	T276I	possibly damaging	Het

Other mutations in Top2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Top2b	APN	14	16422692	missense	probably benign	0.00
IGL00730:Top2b	APN	14	16389831	missense	probably damaging	1.00
IGL00917:Top2b	APN	14	16407354	missense	probably benign	0.05
IGL01959:Top2b	APN	14	16422695	missense	probably benign	0.19
IGL02019:Top2b	APN	14	16409965	missense	probably benign	0.44
IGL02119:Top2b	APN	14	16406733	missense	probably damaging	1.00
IGL02136:Top2b	APN	14	16407103	unclassified	probably benign
IGL02148:Top2b	APN	14	16400488	missense	probably damaging	1.00
IGL02496:Top2b	APN	14	16387335	missense	probably benign
IGL02503:Top2b	APN	14	16407163	missense	possibly damaging	0.92
IGL02672:Top2b	APN	14	16409166	unclassified	probably benign
IGL02721:Top2b	APN	14	16409236	missense	probably damaging	1.00
IGL02886:Top2b	APN	14	16365688	missense	possibly damaging	0.73
IGL03252:Top2b	APN	14	16393163	missense	possibly damaging	0.60
PIT4434001:Top2b	UTSW	14	16423780	critical splice donor site	probably null
R0092:Top2b	UTSW	14	16409263	missense	probably damaging	1.00
R0201:Top2b	UTSW	14	16383174	missense	probably damaging	1.00
R0390:Top2b	UTSW	14	16418442	missense	probably benign	0.00
R0394:Top2b	UTSW	14	16413556	splice site	probably null
R1159:Top2b	UTSW	14	16430329	missense	possibly damaging	0.81
R1424:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R1519:Top2b	UTSW	14	16408953	splice site	probably null
R1561:Top2b	UTSW	14	16398993	missense	possibly damaging	0.80
R1713:Top2b	UTSW	14	16409823	missense	probably benign	0.05
R1987:Top2b	UTSW	14	16398916	missense	probably damaging	0.99
R2219:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2287:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2422:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2679:Top2b	UTSW	14	16413947	missense	probably damaging	1.00
R3687:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3707:Top2b	UTSW	14	16388447	missense	probably damaging	1.00
R3810:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3812:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3815:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3816:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3818:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4023:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4025:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4026:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4133:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4157:Top2b	UTSW	14	16384491	missense	probably benign	0.42
R4179:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4180:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4300:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4376:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4377:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4492:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4549:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4550:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4581:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4582:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4628:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4630:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4667:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4668:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4669:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4698:Top2b	UTSW	14	16387331	nonsense	probably null
R4769:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R4809:Top2b	UTSW	14	16383125	missense	probably benign	0.06
R4899:Top2b	UTSW	14	16387313	missense	probably damaging	1.00
R5035:Top2b	UTSW	14	16409966	missense	probably benign	0.01
R5621:Top2b	UTSW	14	16387280	missense	probably damaging	1.00
R5631:Top2b	UTSW	14	16409882	missense	probably damaging	1.00
R5685:Top2b	UTSW	14	16413666	missense	probably damaging	1.00
R5732:Top2b	UTSW	14	16400106	missense	possibly damaging	0.92
R5939:Top2b	UTSW	14	16422786	missense	probably damaging	0.96
R6007:Top2b	UTSW	14	16423779	critical splice donor site	probably null
R6087:Top2b	UTSW	14	16409864	missense	probably benign	0.14
R6144:Top2b	UTSW	14	16423740	missense	possibly damaging	0.48
R6196:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6218:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6229:Top2b	UTSW	14	16409838	missense	probably damaging	1.00
R6249:Top2b	UTSW	14	16399006	missense	probably damaging	1.00
R6337:Top2b	UTSW	14	16399026	missense	possibly damaging	0.77
R6353:Top2b	UTSW	14	16416671	missense	probably damaging	1.00
R6512:Top2b	UTSW	14	16409854	missense	possibly damaging	0.94
R6573:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R6614:Top2b	UTSW	14	16407142	nonsense	probably null
R6844:Top2b	UTSW	14	16429383	missense	possibly damaging	0.94
R6848:Top2b	UTSW	14	16409958	missense	possibly damaging	0.89
R6871:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6895:Top2b	UTSW	14	16413604	missense	probably benign	0.06
R7162:Top2b	UTSW	14	16416653	missense	probably benign	0.00
R7247:Top2b	UTSW	14	16416962	missense	probably benign	0.08
R7250:Top2b	UTSW	14	16420411	missense	probably benign
R7359:Top2b	UTSW	14	16407376	missense	probably null	1.00
R7365:Top2b	UTSW	14	16416649	missense	probably benign	0.04
R7493:Top2b	UTSW	14	16416605	missense	probably benign	0.00
R7528:Top2b	UTSW	14	16395427	nonsense	probably null
R7562:Top2b	UTSW	14	16412946	missense	probably benign	0.04
R7594:Top2b	UTSW	14	16428587	missense	probably benign
R7670:Top2b	UTSW	14	16416620	missense	possibly damaging	0.61
R7894:Top2b	UTSW	14	16413081	missense	possibly damaging	0.68
R8031:Top2b	UTSW	14	16412986	missense	probably damaging	0.98
R8150:Top2b	UTSW	14	16393291	missense	probably damaging	0.99
R8214:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R8299:Top2b	UTSW	14	16386123	missense	possibly damaging	0.68
R9562:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9565:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9798:Top2b	UTSW	14	16389845	missense	probably damaging	1.00
X0028:Top2b	UTSW	14	16384499	nonsense	probably null
Z1176:Top2b	UTSW	14	16395434	missense	probably damaging	1.00
Z1177:Top2b	UTSW	14	16416953	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCATCATAGGTGAAAGCTGCTG -3'
(R):5'- ATGTTCCACAACCTGACTCC -3'

Sequencing Primer
(F):5'- TCATAGGTGAAAGCTGCTGTAAATG -3'
(R):5'- ACACTAGCCACTTATTTTTGTTGG -3'

Posted On

2021-10-11