Incidental Mutation 'R8977:Top2b'
ID683529
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Nametopoisomerase (DNA) II beta
SynonymsD230016L12Rik, Top-2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R8977 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location16365179-16435462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16393239 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 299 (H299Q)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629]
AlphaFold Q64511
Predicted Effect probably benign
Transcript: ENSMUST00000017629
AA Change: H299Q

PolyPhen 2 Score 0.359 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: H299Q

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,328,408 I984N probably damaging Het
4930438A08Rik A G 11: 58,293,884 E476G unknown Het
Aars G A 8: 111,040,217 R77Q probably damaging Het
Abcc10 C A 17: 46,313,667 V795L probably benign Het
Adam30 A G 3: 98,162,062 K276E probably damaging Het
Adam6b A T 12: 113,490,376 N271I probably benign Het
Adgrl2 T C 3: 148,954,587 I17V probably null Het
Anapc1 C A 2: 128,641,402 G1258C probably damaging Het
Ank2 G T 3: 126,944,926 H2436Q unknown Het
Ankrd13a A T 5: 114,795,745 K267* probably null Het
Apob T C 12: 8,015,990 Y4320H probably damaging Het
Atp2b2 T C 6: 113,773,364 D678G probably damaging Het
Bhlhe41 C A 6: 145,863,370 V239F possibly damaging Het
Cbfa2t2 T G 2: 154,500,490 L42R probably benign Het
Ccdc173 T C 2: 69,787,299 H46R possibly damaging Het
Ccer2 G A 7: 28,756,688 V52M probably damaging Het
Ccnj T C 19: 40,844,939 F187S probably damaging Het
Cd109 G A 9: 78,707,528 V1286I probably benign Het
Cfap46 G T 7: 139,679,933 T148N probably benign Het
Chmp7 A G 14: 69,721,235 V210A probably benign Het
Cuzd1 A G 7: 131,322,025 F8S probably benign Het
Dnmbp A T 19: 43,852,312 D549E probably damaging Het
Dpp4 A G 2: 62,374,403 L240P probably benign Het
Dst A T 1: 34,247,783 R3398S probably damaging Het
Eml6 A G 11: 29,784,182 I1186T possibly damaging Het
Extl1 T C 4: 134,359,124 E540G possibly damaging Het
Gdpd5 A G 7: 99,453,850 I339V probably benign Het
Ggcx T C 6: 72,429,282 probably null Het
Gm9195 A G 14: 72,453,898 F1637L unknown Het
Igkv5-48 G C 6: 69,726,632 N96K possibly damaging Het
Itga11 T C 9: 62,755,640 I546T probably damaging Het
Map3k5 T A 10: 20,079,254 F624L possibly damaging Het
Map7 T A 10: 20,269,590 probably null Het
Mdga2 A T 12: 66,797,635 D196E possibly damaging Het
Mettl2 T C 11: 105,128,965 C143R probably benign Het
Mut G T 17: 40,938,590 R152L probably benign Het
Ncam1 G T 9: 49,507,525 T825K probably damaging Het
Nucb2 C A 7: 116,528,828 N257K probably benign Het
Olfr1085 C T 2: 86,658,128 C110Y probably benign Het
Olfr1535 T A 13: 21,555,846 M59L possibly damaging Het
Olfr378 A G 11: 73,425,825 S53P probably benign Het
Olfr406 A T 11: 74,269,478 I30F probably benign Het
Olfr640 A T 7: 104,021,555 Y254* probably null Het
Olfr664 A T 7: 104,734,041 F108I probably damaging Het
Pamr1 T A 2: 102,611,618 V184D probably damaging Het
Paqr9 A T 9: 95,560,835 I293F possibly damaging Het
Pi15 G T 1: 17,619,902 probably null Het
Pkm T A 9: 59,671,640 I301N probably damaging Het
Pramel1 T A 4: 143,397,391 I212N probably benign Het
Prdm6 A T 18: 53,568,301 I549F probably damaging Het
Prpf8 A G 11: 75,496,044 E1105G probably benign Het
Rad51b T A 12: 79,657,888 V274E probably damaging Het
Rd3l T A 12: 111,980,159 Y61F probably damaging Het
Rgs11 T C 17: 26,208,259 V388A probably damaging Het
Rictor A G 15: 6,783,085 I901V probably benign Het
Riox2 A G 16: 59,491,832 D444G probably benign Het
Scn2a T A 2: 65,763,670 V1621E probably damaging Het
Sec11c A G 18: 65,812,747 I94V possibly damaging Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc34a1 T C 13: 55,409,002 I337T probably benign Het
Slc6a19 T C 13: 73,682,150 K516E probably benign Het
Slco1b2 A T 6: 141,683,254 M596L probably benign Het
Smarce1 A G 11: 99,219,685 I100T possibly damaging Het
Stk32c A T 7: 139,125,245 M119K possibly damaging Het
Tekt2 T C 4: 126,323,473 probably null Het
Tenm4 A T 7: 96,811,970 N908Y probably damaging Het
Tex38 A G 4: 115,780,595 S4P probably benign Het
Trim55 C A 3: 19,659,177 R131S probably benign Het
Vmn2r109 A T 17: 20,554,269 Y275N possibly damaging Het
Vmn2r116 C T 17: 23,386,942 T276I possibly damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
R7894:Top2b UTSW 14 16413081 missense possibly damaging 0.68
R8031:Top2b UTSW 14 16412986 missense probably damaging 0.98
R8150:Top2b UTSW 14 16393291 missense probably damaging 0.99
R8214:Top2b UTSW 14 16383177 missense probably damaging 1.00
R8299:Top2b UTSW 14 16386123 missense possibly damaging 0.68
X0028:Top2b UTSW 14 16384499 nonsense probably null
Z1176:Top2b UTSW 14 16395434 missense probably damaging 1.00
Z1177:Top2b UTSW 14 16416953 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCATCATAGGTGAAAGCTGCTG -3'
(R):5'- ATGTTCCACAACCTGACTCC -3'

Sequencing Primer
(F):5'- TCATAGGTGAAAGCTGCTGTAAATG -3'
(R):5'- ACACTAGCCACTTATTTTTGTTGG -3'
Posted On2021-10-11