Incidental Mutation 'R4946:Adgre1'
ID383459
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Nameadhesion G protein-coupled receptor E1
SynonymsEmr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71
MMRRC Submission 042543-MU
Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R4946 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57358686-57483529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57443918 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 531 (V531I)
Ref Sequence ENSEMBL: ENSMUSP00000083971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
Predicted Effect probably benign
Transcript: ENSMUST00000004850
AA Change: V531I

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: V531I

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086763
AA Change: V531I

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: V531I

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,086,474 D98G probably damaging Het
Aldoart2 A G 12: 55,566,016 Q242R probably benign Het
Ank2 A T 3: 126,941,940 probably benign Het
Ank3 C T 10: 69,898,117 A737V probably damaging Het
Ankle2 A G 5: 110,253,838 I789V probably benign Het
Ankrd13c T C 3: 158,005,773 V510A probably damaging Het
Arid1b T A 17: 5,342,843 M2216K probably damaging Het
Arrdc1 A G 2: 24,925,848 V380A probably benign Het
B3galt1 C A 2: 68,118,569 N209K possibly damaging Het
Cd300c2 A T 11: 114,996,905 C224S probably benign Het
Cdk4 T C 10: 127,064,890 probably null Het
Cdk5rap1 T C 2: 154,368,874 T115A possibly damaging Het
Clvs1 A T 4: 9,281,831 R92* probably null Het
Cnga1 A G 5: 72,604,764 V469A probably damaging Het
Ctns A G 11: 73,196,653 F16L probably benign Het
Dlg5 A T 14: 24,154,361 C1299S probably damaging Het
Dnah3 T A 7: 119,931,560 Y3690F probably damaging Het
Dnah5 A G 15: 28,326,557 M1971V probably damaging Het
Dnah5 G A 15: 28,387,904 V3170M probably damaging Het
Dpp8 T C 9: 65,055,918 Y485H probably benign Het
Dsc2 T C 18: 20,050,157 D68G probably damaging Het
Elavl1 A T 8: 4,301,752 D121E probably benign Het
Ermap A G 4: 119,183,308 V311A probably damaging Het
Fam102b A G 3: 108,980,228 V240A probably benign Het
Fbxw11 C T 11: 32,739,226 R437C probably damaging Het
Gas2l3 T C 10: 89,413,772 M495V probably benign Het
Hacd1 C T 2: 14,045,137 probably null Het
Itgav A G 2: 83,788,983 R596G probably benign Het
Kars T C 8: 112,001,720 H215R possibly damaging Het
Kif26a G A 12: 112,177,794 R1494H probably damaging Het
Klf12 G A 14: 100,022,957 S112L possibly damaging Het
Krt77 T C 15: 101,869,563 Y19C unknown Het
Lrrc4c A G 2: 97,630,489 T487A probably benign Het
Lrrn1 A G 6: 107,568,890 M550V probably benign Het
Lsr C A 7: 30,958,209 R442L probably benign Het
Lysmd2 A C 9: 75,635,446 T112P probably damaging Het
Mctp2 A T 7: 72,259,269 S99T probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mill2 T A 7: 18,856,683 probably null Het
Mpp3 T C 11: 102,005,022 N476D probably benign Het
Mtmr6 C T 14: 60,280,189 P83L possibly damaging Het
Myh3 T C 11: 67,093,538 I1067T probably benign Het
Myh9 C A 15: 77,773,340 Q1068H probably damaging Het
Narf T A 11: 121,250,353 H304Q possibly damaging Het
Nfatc2ip G T 7: 126,396,612 P35Q possibly damaging Het
Npas3 C A 12: 54,065,835 P426Q probably damaging Het
Olfr1289 T C 2: 111,483,966 Y207H possibly damaging Het
Olfr1508 G A 14: 52,463,283 T242I probably damaging Het
Olfr432 T G 1: 174,050,834 S154A possibly damaging Het
Olfr467 A G 7: 107,815,382 H266R possibly damaging Het
Olfr640 T A 7: 104,022,012 Q102L probably damaging Het
Pcdh10 A T 3: 45,379,482 E77V probably damaging Het
Pcnt C T 10: 76,356,185 R2764Q probably damaging Het
Pgbd5 T C 8: 124,370,585 D493G possibly damaging Het
Piezo2 G T 18: 63,157,262 T142N probably benign Het
Plcb1 A G 2: 135,345,095 I761V probably benign Het
Plekhg4 T G 8: 105,381,996 D1196E probably null Het
Pparg A G 6: 115,451,028 K159E probably damaging Het
Psmb1 A T 17: 15,498,216 M16K probably benign Het
Ptprq T C 10: 107,525,734 I2139V probably benign Het
Ralgapb T A 2: 158,440,967 S239T probably damaging Het
Serpina11 A G 12: 103,984,664 V266A probably damaging Het
Sf3a2 C G 10: 80,804,113 probably benign Het
Smim18 T C 8: 33,742,559 T11A possibly damaging Het
Snx6 G A 12: 54,770,743 T7I probably damaging Het
Srcin1 T A 11: 97,551,942 D75V probably damaging Het
Srsf12 T A 4: 33,231,174 S223T probably damaging Het
Taf4b G T 18: 14,813,542 C474F probably damaging Het
Tango6 T A 8: 106,718,090 C542* probably null Het
Tbc1d24 A G 17: 24,208,536 S151P possibly damaging Het
Tssk6 T C 8: 69,903,064 S253P probably benign Het
Ttc39c G A 18: 12,724,942 W300* probably null Het
Ttc6 T A 12: 57,643,140 W539R probably benign Het
Ttn T C 2: 76,752,426 T22708A probably damaging Het
Ttn C A 2: 76,918,709 E3999* probably null Het
Vill T G 9: 119,068,440 L261R probably damaging Het
Vmn1r20 T C 6: 57,432,174 S162P probably damaging Het
Zfp516 T C 18: 82,956,094 I139T probably benign Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57450055 missense probably benign 0.00
IGL00966:Adgre1 APN 17 57419335 missense probably benign 0.04
IGL01680:Adgre1 APN 17 57402620 missense unknown
IGL01724:Adgre1 APN 17 57444064 nonsense probably null
IGL02172:Adgre1 APN 17 57478879 missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57447891 missense probably benign 0.01
IGL02272:Adgre1 APN 17 57450021 nonsense probably null
IGL02336:Adgre1 APN 17 57411024 nonsense probably null
IGL02346:Adgre1 APN 17 57443919 missense probably benign 0.15
IGL02398:Adgre1 APN 17 57402824 nonsense probably null
IGL02618:Adgre1 APN 17 57444021 missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57480921 missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57478833 missense probably benign 0.26
IGL03112:Adgre1 APN 17 57448029 splice site probably null
IGL03350:Adgre1 APN 17 57401908 missense probably benign 0.16
F480 UTSW 17 57444063 missense probably damaging 1.00
lomax UTSW 17 57402811 missense unknown
Onion UTSW 17 57402841 nonsense probably null
Scallion UTSW 17 57401977 missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57402841 nonsense probably null
R0153:Adgre1 UTSW 17 57443939 missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0278:Adgre1 UTSW 17 57447872 missense probably benign 0.07
R0323:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0389:Adgre1 UTSW 17 57406839 missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57402742 missense unknown
R0621:Adgre1 UTSW 17 57441359 missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57411003 missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57447936 missense probably benign 0.00
R1601:Adgre1 UTSW 17 57441353 missense probably benign 0.01
R1689:Adgre1 UTSW 17 57449921 missense probably benign 0.31
R1708:Adgre1 UTSW 17 57401974 missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57441350 missense probably benign 0.43
R1839:Adgre1 UTSW 17 57441299 missense probably benign 0.00
R1860:Adgre1 UTSW 17 57441363 missense probably benign 0.00
R2165:Adgre1 UTSW 17 57419338 missense probably damaging 0.97
R2219:Adgre1 UTSW 17 57401912 missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57410956 missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57401925 missense probably benign 0.08
R3911:Adgre1 UTSW 17 57447860 missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57402811 missense unknown
R4439:Adgre1 UTSW 17 57447954 missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57410947 missense probably benign 0.34
R4529:Adgre1 UTSW 17 57420519 missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57406874 missense probably benign 0.07
R4610:Adgre1 UTSW 17 57450073 missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57480947 missense probably benign 0.20
R4911:Adgre1 UTSW 17 57447832 missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57444064 nonsense probably null
R4942:Adgre1 UTSW 17 57406903 missense probably damaging 1.00
R4953:Adgre1 UTSW 17 57441321 missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57401977 missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57402817 missense probably benign 0.39
R5590:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57420437 missense probably benign 0.15
R5699:Adgre1 UTSW 17 57481007 missense probably benign 0.43
R5734:Adgre1 UTSW 17 57443990 missense probably benign 0.00
R5860:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6149:Adgre1 UTSW 17 57445018 missense probably benign 0.08
R6478:Adgre1 UTSW 17 57401955 missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57406917 missense probably benign 0.10
R6864:Adgre1 UTSW 17 57478879 missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57410844 missense probably benign 0.01
R6945:Adgre1 UTSW 17 57420399 missense probably benign 0.39
R6988:Adgre1 UTSW 17 57408445 missense probably benign 0.00
R7019:Adgre1 UTSW 17 57410945 missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57444087 splice site probably null
R7347:Adgre1 UTSW 17 57420441 missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57449933 missense probably damaging 1.00
R7709:Adgre1 UTSW 17 57402519 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTGCCTCAACTGATCTGAAAATTC -3'
(R):5'- AAACCTGGATGTGCTGGAGG -3'

Sequencing Primer
(F):5'- AGAGTCTGTGTATGTACATGTCAC -3'
(R):5'- CTGGAGGGTATAGATAATAGGCTTG -3'
Posted On2016-04-27