Mutagenetix > Incidental Mutation

Incidental Mutation 'R9352:Cdh23'

708150

Institutional Source

Beutler Lab

Gene Symbol

Cdh23

Ensembl Gene

ENSMUSG00000012819

Gene Name

cadherin related 23 (otocadherin)

Synonyms

bob, sals, USH1D, ahl, mdfw, nmf252, 4930542A03Rik, nmf112, nmf181

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.428) question?

Stock #

R9352 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60138527-60532269 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 60143306 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 3005 (A3005V)

Ref Sequence

ENSEMBL: ENSMUSP00000101101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004316] [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464] [ENSMUST00000105465] [ENSMUST00000165878] [ENSMUST00000177779] [ENSMUST00000179238]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000004316

SMART Domains

Protein: ENSMUSP00000004316
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	272	1.2e-16	SMART
SapB	314	389	2.07e-20	SMART
low complexity region	412	430	N/A	INTRINSIC
SapB	439	514	3.84e-24	SMART
SAPA	523	556	3.19e-22	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073242
AA Change: A3004V

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: A3004V

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	8.11e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1415	1.21e-18	SMART
CA	1440	1524	2.38e-26	SMART
CA	1549	1631	6.27e-26	SMART
CA	1656	1741	6.99e-24	SMART
CA	1765	1848	3.49e-24	SMART
CA	1872	1956	2.78e-18	SMART
CA	1984	2066	5.6e-14	SMART
CA	2090	2171	2.59e-27	SMART
CA	2195	2290	2.87e-11	SMART
CA	2317	2399	1.01e-20	SMART
CA	2423	2506	1.09e-25	SMART
CA	2530	2608	7.91e-23	SMART
CA	2634	2719	1.06e-23	SMART
CA	2750	2843	2e-10	SMART
Blast:CA	2867	2956	4e-51	BLAST
transmembrane domain	3067	3089	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105461
AA Change: A3005V

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: A3005V

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105462
AA Change: A3007V

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: A3007V

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	261	349	2.03e-11	SMART
CA	374	461	8.11e-11	SMART
CA	485	562	1.04e-22	SMART
CA	586	672	3.55e-25	SMART
CA	696	779	2.04e-25	SMART
CA	803	891	5.03e-16	SMART
CA	915	996	1.05e-27	SMART
CA	1020	1103	1.99e-19	SMART
CA	1127	1209	6.94e-19	SMART
CA	1234	1314	1.99e-19	SMART
CA	1338	1418	1.21e-18	SMART
CA	1443	1527	2.38e-26	SMART
CA	1552	1634	6.27e-26	SMART
CA	1659	1744	6.99e-24	SMART
CA	1768	1851	3.49e-24	SMART
CA	1875	1959	2.78e-18	SMART
CA	1987	2069	5.6e-14	SMART
CA	2093	2174	2.59e-27	SMART
CA	2198	2293	2.87e-11	SMART
CA	2320	2402	1.01e-20	SMART
CA	2426	2509	1.09e-25	SMART
CA	2533	2611	7.91e-23	SMART
CA	2637	2722	1.06e-23	SMART
CA	2753	2846	2e-10	SMART
Blast:CA	2870	2959	4e-51	BLAST
transmembrane domain	3070	3092	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105463
AA Change: A3005V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: A3005V

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105464
AA Change: A3003V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: A3003V

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	456	3.58e-12	SMART
CA	480	557	1.04e-22	SMART
CA	581	667	3.55e-25	SMART
CA	691	774	2.04e-25	SMART
CA	798	886	5.03e-16	SMART
CA	910	991	1.05e-27	SMART
CA	1015	1098	1.99e-19	SMART
CA	1122	1204	6.94e-19	SMART
CA	1229	1309	1.99e-19	SMART
CA	1333	1414	5.26e-19	SMART
CA	1439	1523	2.38e-26	SMART
CA	1548	1630	6.27e-26	SMART
CA	1655	1740	6.99e-24	SMART
CA	1764	1847	3.49e-24	SMART
CA	1871	1955	2.78e-18	SMART
CA	1983	2065	5.6e-14	SMART
CA	2089	2170	2.59e-27	SMART
CA	2194	2289	2.87e-11	SMART
CA	2316	2398	1.01e-20	SMART
CA	2422	2505	1.09e-25	SMART
CA	2529	2607	7.91e-23	SMART
CA	2633	2718	1.06e-23	SMART
CA	2749	2842	2e-10	SMART
Blast:CA	2866	2955	3e-51	BLAST
transmembrane domain	3066	3088	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105465

SMART Domains

Protein: ENSMUSP00000101105
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	270	2.76e-16	SMART
SapB	312	387	2.07e-20	SMART
low complexity region	410	428	N/A	INTRINSIC
SapB	437	512	3.84e-24	SMART
SAPA	521	554	3.19e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165878

SMART Domains

Protein: ENSMUSP00000126407
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
SAPA	18	51	1.4e-18	SMART
SapB	58	135	1.87e-27	SMART
SapB	192	267	2.76e-16	SMART
SapB	309	384	2.07e-20	SMART
low complexity region	407	425	N/A	INTRINSIC
SapB	434	509	3.84e-24	SMART
SAPA	518	551	3.19e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177779

SMART Domains

Protein: ENSMUSP00000137286
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	273	2.37e-15	SMART
SapB	315	390	2.07e-20	SMART
low complexity region	413	431	N/A	INTRINSIC
SapB	440	515	3.84e-24	SMART
SAPA	524	557	3.19e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179238

SMART Domains

Protein: ENSMUSP00000137476
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	273	8.5e-17	SMART
SapB	315	390	2.07e-20	SMART
low complexity region	413	431	N/A	INTRINSIC
SapB	440	515	3.84e-24	SMART
SAPA	524	557	3.19e-22	SMART

Meta Mutation Damage Score

0.0825

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl3	A	T	7: 82,091,656 (GRCm39)	Q123L	probably damaging	Het
Adarb2	T	A	13: 8,807,428 (GRCm39)	L743Q	probably damaging	Het
Alpk2	C	A	18: 65,439,783 (GRCm39)	D537Y	probably benign	Het
Anxa4	C	T	6: 86,742,775 (GRCm39)		probably benign	Het
Arfgap3	T	A	15: 83,191,127 (GRCm39)	I464L	possibly damaging	Het
Asb2	C	T	12: 103,296,698 (GRCm39)	V320I	probably damaging	Het
Axl	T	C	7: 25,462,752 (GRCm39)	T659A	possibly damaging	Het
Bbof1	A	G	12: 84,461,394 (GRCm39)	H139R	probably benign	Het
Birc6	G	A	17: 74,965,347 (GRCm39)		probably null	Het
Chil3	A	T	3: 106,067,787 (GRCm39)	F126Y	probably damaging	Het
Chrnb4	T	A	9: 54,951,167 (GRCm39)	D32V	probably benign	Het
Chst15	C	A	7: 131,872,257 (GRCm39)	C8F	probably damaging	Het
Cntnap5c	A	G	17: 58,399,463 (GRCm39)	I439V	probably benign	Het
Crisp2	T	A	17: 41,078,200 (GRCm39)	N194I	probably damaging	Het
Csrnp1	G	A	9: 119,801,997 (GRCm39)	T354M	probably benign	Het
Cul1	T	A	6: 47,479,426 (GRCm39)	S231T	probably benign	Het
Cyp27a1	C	T	1: 74,752,920 (GRCm39)	T44M	possibly damaging	Het
Dgkg	T	C	16: 22,398,581 (GRCm39)	D232G	probably damaging	Het
Dnah1	G	T	14: 31,038,620 (GRCm39)	Q154K	probably benign	Het
Dnmt1	A	G	9: 20,840,384 (GRCm39)	V304A	probably benign	Het
Dok6	T	C	18: 89,492,133 (GRCm39)	N148S	probably benign	Het
Fnta	A	T	8: 26,501,119 (GRCm39)	W134R	probably damaging	Het
Garin5b	T	A	7: 4,761,605 (GRCm39)	Y369F		Het
Gm32742	T	G	9: 51,052,544 (GRCm39)	Q1441P	possibly damaging	Het
Gm3486	T	C	14: 41,208,318 (GRCm39)	Q131R	possibly damaging	Het
Gnptab	A	G	10: 88,268,350 (GRCm39)	N486D	probably benign	Het
H2-Q4	T	G	17: 35,601,909 (GRCm39)	F257C	probably damaging	Het
Hfe	A	G	13: 23,890,119 (GRCm39)	V218A	probably benign	Het
Htr2b	A	G	1: 86,027,294 (GRCm39)	V404A	probably benign	Het
Hyou1	T	A	9: 44,300,926 (GRCm39)		probably null	Het
Ikbkb	T	C	8: 23,150,444 (GRCm39)	D746G	probably benign	Het
Ikzf4	T	C	10: 128,472,623 (GRCm39)	N251S	probably benign	Het
Il23r	A	C	6: 67,403,592 (GRCm39)	N436K	probably damaging	Het
Impg2	A	T	16: 56,072,470 (GRCm39)	I301L	probably benign	Het
Irf4	A	T	13: 30,936,706 (GRCm39)	M146L	probably benign	Het
Iws1	G	A	18: 32,213,213 (GRCm39)	E214K	possibly damaging	Het
Kctd3	T	C	1: 188,704,777 (GRCm39)	S665G	probably damaging	Het
Kiz	T	C	2: 146,794,927 (GRCm39)	S596P	probably damaging	Het
Kpna2	T	C	11: 106,880,292 (GRCm39)	E452G	probably damaging	Het
Lclat1	A	G	17: 73,468,937 (GRCm39)	Y39C	probably damaging	Het
Lig3	A	G	11: 82,686,971 (GRCm39)	S705G	probably benign	Het
Lrp1b	T	C	2: 40,748,438 (GRCm39)	D3134G		Het
Map3k8	C	T	18: 4,349,170 (GRCm39)	M49I	probably benign	Het
Mep1b	A	G	18: 21,209,431 (GRCm39)	D54G	probably damaging	Het
Mgat5b	T	A	11: 116,857,533 (GRCm39)	S342R	probably benign	Het
Mthfd2l	G	T	5: 91,109,172 (GRCm39)	V201L	possibly damaging	Het
Naip6	G	T	13: 100,437,893 (GRCm39)	T371K	possibly damaging	Het
Naxd	T	C	8: 11,555,504 (GRCm39)	I104T	probably damaging	Het
Nbeal2	T	A	9: 110,456,916 (GRCm39)	I2361F	probably benign	Het
Ogfr	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	2: 180,237,059 (GRCm39)		probably benign	Het
Or1e17	A	G	11: 73,831,470 (GRCm39)	T133A	probably benign	Het
Or6c75	A	T	10: 129,337,364 (GRCm39)	M196L	probably benign	Het
Or8b8	A	G	9: 37,808,712 (GRCm39)	E4G	probably benign	Het
Or8c16	T	G	9: 38,130,683 (GRCm39)	L185R	probably damaging	Het
Pga5	C	T	19: 10,646,897 (GRCm39)	G303S	probably damaging	Het
Polq	T	C	16: 36,862,252 (GRCm39)	F591L	probably damaging	Het
Ppp2r1a	A	T	17: 21,185,499 (GRCm39)		probably null	Het
Prrc1	A	G	18: 57,522,317 (GRCm39)	Y383C	probably damaging	Het
Ptgfr	A	T	3: 151,541,160 (GRCm39)	V116D	probably damaging	Het
Qpctl	C	T	7: 18,878,599 (GRCm39)	R292Q	possibly damaging	Het
Rasip1	G	A	7: 45,278,280 (GRCm39)	V194M	possibly damaging	Het
Rbbp4	A	T	4: 129,211,498 (GRCm39)	N385K	probably benign	Het
Rbbp8nl	A	G	2: 179,921,053 (GRCm39)	S444P	probably benign	Het
Resf1	T	C	6: 149,236,180 (GRCm39)	F1500S	probably damaging	Het
Sf3a1	G	A	11: 4,110,494 (GRCm39)	A3T	unknown	Het
Slc1a4	A	G	11: 20,282,025 (GRCm39)	S150P	probably damaging	Het
Slc28a2	T	C	2: 122,281,522 (GRCm39)		probably null	Het
Slc30a5	A	G	13: 100,940,380 (GRCm39)	I702T	probably benign	Het
Slc36a4	T	A	9: 15,633,319 (GRCm39)		probably null	Het
Slf2	A	G	19: 44,931,957 (GRCm39)	R671G	probably null	Het
Smarcc1	A	G	9: 110,035,220 (GRCm39)	K881R	probably null	Het
Srsf11	A	G	3: 157,717,836 (GRCm39)	V414A	unknown	Het
Tcn2	T	C	11: 3,873,446 (GRCm39)	N300S	probably damaging	Het
Tecta	T	C	9: 42,249,147 (GRCm39)	K1905R	probably damaging	Het
Tex30	T	G	1: 44,130,753 (GRCm39)		probably null	Het
Tktl2	A	T	8: 66,965,974 (GRCm39)	I511F	possibly damaging	Het
Tpp1	G	T	7: 105,398,881 (GRCm39)	Q183K	probably benign	Het
Trib2	A	C	12: 15,865,413 (GRCm39)	I30R	probably benign	Het
Tti1	A	G	2: 157,842,692 (GRCm39)	L779P	probably benign	Het
Unc13b	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	4: 43,177,312 (GRCm39)		probably benign	Het
Unc13b	GAGCCA	GAGCCATAGCCA	4: 43,177,313 (GRCm39)		probably null	Het
Vmn2r112	A	G	17: 22,822,479 (GRCm39)	T386A	probably damaging	Het
Vps16	T	C	2: 130,283,823 (GRCm39)		probably null	Het
Zan	T	G	5: 137,434,745 (GRCm39)	N2186T	unknown	Het
Zdhhc11	C	T	13: 74,121,800 (GRCm39)	R104*	probably null	Het
Zfp318	T	G	17: 46,721,284 (GRCm39)	H1176Q	probably damaging	Het
Zfp335	G	A	2: 164,742,242 (GRCm39)	H581Y	probably damaging	Het
Zfp7	T	C	15: 76,775,674 (GRCm39)	I572T	probably damaging	Het
Zfp955a	T	C	17: 33,461,335 (GRCm39)	T266A	probably benign	Het

Other mutations in Cdh23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Cdh23	APN	10	60,359,327 (GRCm39)	missense	probably benign	0.03
IGL00429:Cdh23	APN	10	60,256,920 (GRCm39)	missense	probably damaging	0.97
IGL01014:Cdh23	APN	10	60,143,301 (GRCm39)	missense	probably damaging	0.99
IGL01284:Cdh23	APN	10	60,301,876 (GRCm39)	missense	possibly damaging	0.95
IGL01305:Cdh23	APN	10	60,148,403 (GRCm39)	missense	probably damaging	1.00
IGL01367:Cdh23	APN	10	60,146,566 (GRCm39)	missense	probably damaging	1.00
IGL01396:Cdh23	APN	10	60,220,848 (GRCm39)	missense	possibly damaging	0.93
IGL01412:Cdh23	APN	10	60,150,473 (GRCm39)	missense	probably damaging	1.00
IGL01461:Cdh23	APN	10	60,244,926 (GRCm39)	missense	possibly damaging	0.53
IGL01469:Cdh23	APN	10	60,433,504 (GRCm39)	missense	probably benign	0.03
IGL01695:Cdh23	APN	10	60,167,612 (GRCm39)	missense	probably benign	0.20
IGL01734:Cdh23	APN	10	60,139,292 (GRCm39)	missense	probably benign
IGL01767:Cdh23	APN	10	60,151,503 (GRCm39)	missense	probably damaging	1.00
IGL01796:Cdh23	APN	10	60,146,916 (GRCm39)	missense	probably benign	0.31
IGL01843:Cdh23	APN	10	60,255,598 (GRCm39)	splice site	probably null
IGL02025:Cdh23	APN	10	60,220,922 (GRCm39)	missense	probably damaging	1.00
IGL02071:Cdh23	APN	10	60,359,339 (GRCm39)	missense	possibly damaging	0.93
IGL02160:Cdh23	APN	10	60,433,544 (GRCm39)	splice site	probably benign
IGL02175:Cdh23	APN	10	60,167,087 (GRCm39)	missense	possibly damaging	0.92
IGL02220:Cdh23	APN	10	60,140,903 (GRCm39)	missense	probably damaging	1.00
IGL02302:Cdh23	APN	10	60,159,302 (GRCm39)	missense	possibly damaging	0.87
IGL02331:Cdh23	APN	10	60,301,322 (GRCm39)	missense	probably damaging	0.99
IGL02452:Cdh23	APN	10	60,153,721 (GRCm39)	missense	probably damaging	0.99
IGL02499:Cdh23	APN	10	60,220,958 (GRCm39)	missense	probably damaging	1.00
IGL02548:Cdh23	APN	10	60,485,901 (GRCm39)	missense	probably benign	0.37
IGL02593:Cdh23	APN	10	60,301,774 (GRCm39)	splice site	probably benign
IGL02626:Cdh23	APN	10	60,227,580 (GRCm39)	missense	probably damaging	1.00
IGL02951:Cdh23	APN	10	60,147,143 (GRCm39)	missense	probably damaging	1.00
IGL03145:Cdh23	APN	10	60,212,593 (GRCm39)	missense	probably damaging	0.99
dee_dee	UTSW	10	60,143,835 (GRCm39)	nonsense	probably null
hersey	UTSW	10	60,143,815 (GRCm39)	missense	probably damaging	1.00
ANU22:Cdh23	UTSW	10	60,148,403 (GRCm39)	missense	probably damaging	1.00
IGL02980:Cdh23	UTSW	10	60,150,399 (GRCm39)	missense	probably damaging	1.00
PIT4362001:Cdh23	UTSW	10	60,301,237 (GRCm39)	missense	probably benign	0.15
R0013:Cdh23	UTSW	10	60,248,952 (GRCm39)	missense	possibly damaging	0.90
R0045:Cdh23	UTSW	10	60,366,757 (GRCm39)	missense	probably damaging	1.00
R0045:Cdh23	UTSW	10	60,366,757 (GRCm39)	missense	probably damaging	1.00
R0082:Cdh23	UTSW	10	60,148,366 (GRCm39)	missense	probably damaging	1.00
R0124:Cdh23	UTSW	10	60,143,835 (GRCm39)	nonsense	probably null
R0172:Cdh23	UTSW	10	60,155,411 (GRCm39)	missense	probably damaging	1.00
R0195:Cdh23	UTSW	10	60,152,838 (GRCm39)	missense	probably damaging	0.99
R0365:Cdh23	UTSW	10	60,215,094 (GRCm39)	missense	probably damaging	0.99
R0437:Cdh23	UTSW	10	60,246,576 (GRCm39)	missense	probably damaging	1.00
R0486:Cdh23	UTSW	10	60,222,725 (GRCm39)	missense	probably damaging	1.00
R0494:Cdh23	UTSW	10	60,152,375 (GRCm39)	splice site	probably benign
R0545:Cdh23	UTSW	10	60,167,070 (GRCm39)	missense	probably benign	0.06
R0619:Cdh23	UTSW	10	60,269,556 (GRCm39)	missense	probably damaging	1.00
R0647:Cdh23	UTSW	10	60,159,153 (GRCm39)	nonsense	probably null
R0647:Cdh23	UTSW	10	60,143,681 (GRCm39)	missense	probably damaging	0.99
R0730:Cdh23	UTSW	10	60,159,493 (GRCm39)	missense	probably damaging	0.99
R0880:Cdh23	UTSW	10	60,242,200 (GRCm39)	missense	possibly damaging	0.51
R0942:Cdh23	UTSW	10	60,246,639 (GRCm39)	missense	possibly damaging	0.67
R0989:Cdh23	UTSW	10	60,370,289 (GRCm39)	missense	probably damaging	0.99
R1017:Cdh23	UTSW	10	60,167,572 (GRCm39)	missense	probably damaging	1.00
R1173:Cdh23	UTSW	10	60,148,171 (GRCm39)	splice site	probably benign
R1449:Cdh23	UTSW	10	60,212,730 (GRCm39)	missense	probably damaging	1.00
R1456:Cdh23	UTSW	10	60,322,899 (GRCm39)	missense	possibly damaging	0.84
R1519:Cdh23	UTSW	10	60,215,122 (GRCm39)	missense	possibly damaging	0.92
R1532:Cdh23	UTSW	10	60,150,110 (GRCm39)	missense	probably damaging	0.99
R1559:Cdh23	UTSW	10	60,255,478 (GRCm39)	splice site	probably benign
R1704:Cdh23	UTSW	10	60,150,390 (GRCm39)	missense	probably damaging	1.00
R1711:Cdh23	UTSW	10	60,359,315 (GRCm39)	missense	probably benign	0.07
R1760:Cdh23	UTSW	10	60,161,855 (GRCm39)	missense	probably damaging	1.00
R1782:Cdh23	UTSW	10	60,324,321 (GRCm39)	missense	probably damaging	1.00
R1791:Cdh23	UTSW	10	60,227,505 (GRCm39)	missense	possibly damaging	0.89
R1803:Cdh23	UTSW	10	60,167,060 (GRCm39)	missense	probably damaging	1.00
R1857:Cdh23	UTSW	10	60,159,076 (GRCm39)	missense	probably damaging	1.00
R1874:Cdh23	UTSW	10	60,272,597 (GRCm39)	missense	possibly damaging	0.52
R1914:Cdh23	UTSW	10	60,159,349 (GRCm39)	missense	probably damaging	0.99
R1958:Cdh23	UTSW	10	60,246,652 (GRCm39)	missense	probably benign	0.02
R1964:Cdh23	UTSW	10	60,221,001 (GRCm39)	missense	probably benign	0.31
R1966:Cdh23	UTSW	10	60,159,361 (GRCm39)	missense	probably damaging	1.00
R1981:Cdh23	UTSW	10	60,214,530 (GRCm39)	missense	probably damaging	1.00
R2010:Cdh23	UTSW	10	60,150,006 (GRCm39)	missense	probably damaging	0.99
R2036:Cdh23	UTSW	10	60,301,822 (GRCm39)	missense	possibly damaging	0.52
R2038:Cdh23	UTSW	10	60,148,366 (GRCm39)	missense	probably damaging	1.00
R2044:Cdh23	UTSW	10	60,432,509 (GRCm39)	missense	possibly damaging	0.72
R2111:Cdh23	UTSW	10	60,141,362 (GRCm39)	missense	probably damaging	0.99
R2112:Cdh23	UTSW	10	60,141,362 (GRCm39)	missense	probably damaging	0.99
R2211:Cdh23	UTSW	10	60,301,783 (GRCm39)	missense	possibly damaging	0.92
R2261:Cdh23	UTSW	10	60,152,907 (GRCm39)	missense	probably damaging	1.00
R2262:Cdh23	UTSW	10	60,152,907 (GRCm39)	missense	probably damaging	1.00
R2306:Cdh23	UTSW	10	60,159,224 (GRCm39)	missense	probably damaging	1.00
R2344:Cdh23	UTSW	10	60,152,503 (GRCm39)	missense	probably damaging	1.00
R2857:Cdh23	UTSW	10	60,218,432 (GRCm39)	critical splice donor site	probably null
R2858:Cdh23	UTSW	10	60,218,432 (GRCm39)	critical splice donor site	probably null
R2859:Cdh23	UTSW	10	60,218,432 (GRCm39)	critical splice donor site	probably null
R2876:Cdh23	UTSW	10	60,143,275 (GRCm39)	missense	probably damaging	1.00
R3034:Cdh23	UTSW	10	60,244,789 (GRCm39)	splice site	probably benign
R3424:Cdh23	UTSW	10	60,212,660 (GRCm39)	missense	possibly damaging	0.76
R3699:Cdh23	UTSW	10	60,163,149 (GRCm39)	critical splice donor site	probably null
R3700:Cdh23	UTSW	10	60,163,149 (GRCm39)	critical splice donor site	probably null
R3950:Cdh23	UTSW	10	60,493,105 (GRCm39)	missense	probably benign	0.04
R3951:Cdh23	UTSW	10	60,493,105 (GRCm39)	missense	probably benign	0.04
R3952:Cdh23	UTSW	10	60,493,105 (GRCm39)	missense	probably benign	0.04
R4108:Cdh23	UTSW	10	60,246,601 (GRCm39)	missense	possibly damaging	0.51
R4114:Cdh23	UTSW	10	60,256,819 (GRCm39)	splice site	probably null
R4273:Cdh23	UTSW	10	60,146,940 (GRCm39)	missense	possibly damaging	0.69
R4284:Cdh23	UTSW	10	60,139,272 (GRCm39)	missense	possibly damaging	0.91
R4334:Cdh23	UTSW	10	60,220,838 (GRCm39)	missense	probably damaging	0.99
R4474:Cdh23	UTSW	10	60,146,865 (GRCm39)	missense	probably damaging	1.00
R4532:Cdh23	UTSW	10	60,370,202 (GRCm39)	missense	probably benign	0.32
R4597:Cdh23	UTSW	10	60,244,823 (GRCm39)	missense	probably damaging	1.00
R4604:Cdh23	UTSW	10	60,173,445 (GRCm39)	missense	possibly damaging	0.93
R4793:Cdh23	UTSW	10	60,167,129 (GRCm39)	missense	probably damaging	1.00
R4816:Cdh23	UTSW	10	60,244,856 (GRCm39)	missense	possibly damaging	0.93
R4833:Cdh23	UTSW	10	60,220,817 (GRCm39)	missense	probably damaging	1.00
R4840:Cdh23	UTSW	10	60,255,556 (GRCm39)	missense	possibly damaging	0.53
R4857:Cdh23	UTSW	10	60,227,563 (GRCm39)	missense	probably damaging	1.00
R4869:Cdh23	UTSW	10	60,212,713 (GRCm39)	missense	probably damaging	1.00
R4894:Cdh23	UTSW	10	60,173,630 (GRCm39)	missense	probably benign	0.04
R4940:Cdh23	UTSW	10	60,143,714 (GRCm39)	missense	probably damaging	0.98
R5020:Cdh23	UTSW	10	60,143,811 (GRCm39)	missense	probably damaging	0.99
R5026:Cdh23	UTSW	10	60,140,627 (GRCm39)	missense	possibly damaging	0.88
R5081:Cdh23	UTSW	10	60,272,586 (GRCm39)	missense	possibly damaging	0.89
R5138:Cdh23	UTSW	10	60,148,061 (GRCm39)	missense	probably damaging	1.00
R5236:Cdh23	UTSW	10	60,148,351 (GRCm39)	missense	probably damaging	1.00
R5361:Cdh23	UTSW	10	60,493,044 (GRCm39)	critical splice donor site	probably null
R5384:Cdh23	UTSW	10	60,173,541 (GRCm39)	missense	probably damaging	0.99
R5500:Cdh23	UTSW	10	60,150,090 (GRCm39)	missense	probably damaging	1.00
R5512:Cdh23	UTSW	10	60,370,165 (GRCm39)	splice site	probably null
R5673:Cdh23	UTSW	10	60,143,636 (GRCm39)	missense	probably damaging	1.00
R5720:Cdh23	UTSW	10	60,228,802 (GRCm39)	missense	possibly damaging	0.71
R5726:Cdh23	UTSW	10	60,243,259 (GRCm39)	missense	probably damaging	0.98
R5732:Cdh23	UTSW	10	60,167,096 (GRCm39)	missense	possibly damaging	0.80
R5739:Cdh23	UTSW	10	60,141,388 (GRCm39)	missense	probably damaging	0.99
R5760:Cdh23	UTSW	10	60,242,171 (GRCm39)	missense	probably damaging	0.99
R5793:Cdh23	UTSW	10	60,141,907 (GRCm39)	missense	probably damaging	1.00
R5880:Cdh23	UTSW	10	60,220,713 (GRCm39)	missense	probably damaging	1.00
R5905:Cdh23	UTSW	10	60,370,314 (GRCm39)	missense	probably damaging	0.98
R5907:Cdh23	UTSW	10	60,264,158 (GRCm39)	missense	probably damaging	1.00
R5910:Cdh23	UTSW	10	60,213,600 (GRCm39)	missense	possibly damaging	0.81
R5932:Cdh23	UTSW	10	60,228,763 (GRCm39)	missense	probably damaging	1.00
R5996:Cdh23	UTSW	10	60,249,356 (GRCm39)	missense	possibly damaging	0.85
R6015:Cdh23	UTSW	10	60,143,761 (GRCm39)	missense	probably damaging	0.97
R6020:Cdh23	UTSW	10	60,167,105 (GRCm39)	missense	probably damaging	1.00
R6023:Cdh23	UTSW	10	60,301,321 (GRCm39)	missense	probably damaging	1.00
R6028:Cdh23	UTSW	10	60,370,314 (GRCm39)	missense	probably damaging	0.98
R6066:Cdh23	UTSW	10	60,269,537 (GRCm39)	missense	probably damaging	1.00
R6137:Cdh23	UTSW	10	60,270,291 (GRCm39)	missense	probably damaging	0.96
R6211:Cdh23	UTSW	10	60,246,600 (GRCm39)	missense	possibly damaging	0.90
R6298:Cdh23	UTSW	10	60,262,451 (GRCm39)	nonsense	probably null
R6302:Cdh23	UTSW	10	60,140,872 (GRCm39)	missense	possibly damaging	0.74
R6338:Cdh23	UTSW	10	60,248,930 (GRCm39)	missense	probably damaging	1.00
R6356:Cdh23	UTSW	10	60,274,626 (GRCm39)	missense	probably damaging	1.00
R6441:Cdh23	UTSW	10	60,143,815 (GRCm39)	missense	probably damaging	1.00
R6714:Cdh23	UTSW	10	60,167,609 (GRCm39)	missense	possibly damaging	0.62
R6760:Cdh23	UTSW	10	60,141,947 (GRCm39)	missense	probably damaging	1.00
R6807:Cdh23	UTSW	10	60,214,650 (GRCm39)	missense	possibly damaging	0.95
R6855:Cdh23	UTSW	10	60,141,901 (GRCm39)	missense	possibly damaging	0.66
R6937:Cdh23	UTSW	10	60,322,893 (GRCm39)	missense	probably damaging	1.00
R6942:Cdh23	UTSW	10	60,274,635 (GRCm39)	missense	possibly damaging	0.93
R6961:Cdh23	UTSW	10	60,485,893 (GRCm39)	missense	probably benign	0.00
R7009:Cdh23	UTSW	10	60,173,085 (GRCm39)	missense	probably damaging	0.99
R7010:Cdh23	UTSW	10	60,366,770 (GRCm39)	missense	probably benign	0.03
R7032:Cdh23	UTSW	10	60,167,567 (GRCm39)	missense	probably damaging	1.00
R7046:Cdh23	UTSW	10	60,214,530 (GRCm39)	missense	probably damaging	1.00
R7111:Cdh23	UTSW	10	60,222,823 (GRCm39)	missense	probably damaging	1.00
R7196:Cdh23	UTSW	10	60,143,759 (GRCm39)	missense	probably damaging	0.99
R7198:Cdh23	UTSW	10	60,148,378 (GRCm39)	missense	possibly damaging	0.91
R7223:Cdh23	UTSW	10	60,167,596 (GRCm39)	missense	probably damaging	1.00
R7290:Cdh23	UTSW	10	60,212,620 (GRCm39)	missense	probably benign
R7335:Cdh23	UTSW	10	60,140,895 (GRCm39)	missense	probably damaging	1.00
R7340:Cdh23	UTSW	10	60,366,775 (GRCm39)	missense	probably benign	0.19
R7350:Cdh23	UTSW	10	60,246,689 (GRCm39)	missense	probably damaging	1.00
R7366:Cdh23	UTSW	10	60,151,471 (GRCm39)	nonsense	probably null
R7374:Cdh23	UTSW	10	60,153,679 (GRCm39)	missense	probably damaging	0.99
R7455:Cdh23	UTSW	10	60,142,003 (GRCm39)	missense	possibly damaging	0.82
R7537:Cdh23	UTSW	10	60,220,724 (GRCm39)	missense	probably benign	0.17
R7573:Cdh23	UTSW	10	60,159,329 (GRCm39)	missense	probably benign	0.17
R7578:Cdh23	UTSW	10	60,243,186 (GRCm39)	missense	probably benign	0.14
R7646:Cdh23	UTSW	10	60,140,931 (GRCm39)	missense	possibly damaging	0.95
R7703:Cdh23	UTSW	10	60,173,043 (GRCm39)	missense	probably damaging	1.00
R7763:Cdh23	UTSW	10	60,148,356 (GRCm39)	missense	probably damaging	1.00
R7797:Cdh23	UTSW	10	60,220,973 (GRCm39)	missense	probably benign	0.07
R7867:Cdh23	UTSW	10	60,150,390 (GRCm39)	missense	probably damaging	1.00
R7878:Cdh23	UTSW	10	60,149,979 (GRCm39)	missense	possibly damaging	0.69
R7915:Cdh23	UTSW	10	60,143,668 (GRCm39)	missense	probably damaging	0.97
R7922:Cdh23	UTSW	10	60,218,485 (GRCm39)	missense	probably benign	0.31
R7963:Cdh23	UTSW	10	60,171,967 (GRCm39)	missense	probably damaging	1.00
R7997:Cdh23	UTSW	10	60,432,518 (GRCm39)	missense	possibly damaging	0.81
R8167:Cdh23	UTSW	10	60,150,162 (GRCm39)	missense	probably benign	0.12
R8167:Cdh23	UTSW	10	60,173,472 (GRCm39)	missense	probably damaging	0.96
R8258:Cdh23	UTSW	10	60,151,435 (GRCm39)	missense	probably damaging	0.99
R8259:Cdh23	UTSW	10	60,151,435 (GRCm39)	missense	probably damaging	0.99
R8317:Cdh23	UTSW	10	60,272,568 (GRCm39)	missense	probably damaging	1.00
R8317:Cdh23	UTSW	10	60,147,037 (GRCm39)	critical splice donor site	probably null
R8326:Cdh23	UTSW	10	60,274,591 (GRCm39)	missense	possibly damaging	0.55
R8333:Cdh23	UTSW	10	60,150,390 (GRCm39)	missense	probably damaging	1.00
R8348:Cdh23	UTSW	10	60,167,507 (GRCm39)	missense	probably benign	0.43
R8366:Cdh23	UTSW	10	60,160,799 (GRCm39)	missense	probably benign
R8504:Cdh23	UTSW	10	60,274,618 (GRCm39)	missense	probably benign	0.00
R8676:Cdh23	UTSW	10	60,246,689 (GRCm39)	missense	probably damaging	1.00
R8781:Cdh23	UTSW	10	60,167,567 (GRCm39)	missense	probably damaging	1.00
R8785:Cdh23	UTSW	10	60,147,114 (GRCm39)	missense	probably damaging	1.00
R8788:Cdh23	UTSW	10	60,324,372 (GRCm39)	missense	probably damaging	1.00
R8802:Cdh23	UTSW	10	60,244,877 (GRCm39)	missense	probably benign	0.04
R8837:Cdh23	UTSW	10	60,160,755 (GRCm39)	missense	probably benign	0.28
R8863:Cdh23	UTSW	10	60,212,613 (GRCm39)	nonsense	probably null
R8889:Cdh23	UTSW	10	60,143,284 (GRCm39)	missense	probably damaging	0.97
R8892:Cdh23	UTSW	10	60,143,284 (GRCm39)	missense	probably damaging	0.97
R8921:Cdh23	UTSW	10	60,140,908 (GRCm39)	missense	probably damaging	0.99
R8980:Cdh23	UTSW	10	60,173,625 (GRCm39)	missense	probably benign	0.06
R9000:Cdh23	UTSW	10	60,140,277 (GRCm39)	missense	possibly damaging	0.82
R9043:Cdh23	UTSW	10	60,151,478 (GRCm39)	missense	probably benign	0.00
R9046:Cdh23	UTSW	10	60,218,303 (GRCm39)	intron	probably benign
R9070:Cdh23	UTSW	10	60,173,539 (GRCm39)	missense	probably benign
R9075:Cdh23	UTSW	10	60,153,541 (GRCm39)	missense	probably damaging	1.00
R9132:Cdh23	UTSW	10	60,270,283 (GRCm39)	splice site	probably benign
R9155:Cdh23	UTSW	10	60,249,485 (GRCm39)	missense	probably damaging	0.99
R9171:Cdh23	UTSW	10	60,161,810 (GRCm39)	missense	probably benign	0.00
R9179:Cdh23	UTSW	10	60,153,664 (GRCm39)	missense	probably benign	0.06
R9186:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9189:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9207:Cdh23	UTSW	10	60,243,210 (GRCm39)	missense	probably damaging	1.00
R9240:Cdh23	UTSW	10	60,215,044 (GRCm39)	missense	probably benign	0.00
R9244:Cdh23	UTSW	10	60,249,442 (GRCm39)	missense	possibly damaging	0.93
R9284:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9286:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9287:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9302:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9353:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9423:Cdh23	UTSW	10	60,148,387 (GRCm39)	missense	probably damaging	1.00
R9513:Cdh23	UTSW	10	60,166,995 (GRCm39)	missense	probably damaging	0.99
R9577:Cdh23	UTSW	10	60,146,895 (GRCm39)	missense	probably damaging	1.00
R9598:Cdh23	UTSW	10	60,214,574 (GRCm39)	missense	probably benign	0.01
R9631:Cdh23	UTSW	10	60,243,168 (GRCm39)	missense	possibly damaging	0.49
R9652:Cdh23	UTSW	10	60,167,135 (GRCm39)	missense	probably damaging	1.00
R9725:Cdh23	UTSW	10	60,432,561 (GRCm39)	missense	probably benign	0.02
X0052:Cdh23	UTSW	10	60,220,913 (GRCm39)	missense	probably damaging	1.00
Z1088:Cdh23	UTSW	10	60,249,423 (GRCm39)	missense	probably benign	0.35
Z1176:Cdh23	UTSW	10	60,264,100 (GRCm39)	missense	probably benign
Z1176:Cdh23	UTSW	10	60,146,549 (GRCm39)	missense	probably damaging	1.00
Z1177:Cdh23	UTSW	10	60,270,393 (GRCm39)	critical splice acceptor site	probably null
Z1177:Cdh23	UTSW	10	60,159,334 (GRCm39)	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GCAAAGTCTGTGCCTCCTTTG -3'
(R):5'- CCTTATGTGGGAGTTAGCAGC -3'

Sequencing Primer
(F):5'- ATGCACACACATATACACATGTAC -3'
(R):5'- AGTTAGCAGCCGAGTCCAG -3'

Posted On

2022-04-18