Incidental Mutation 'R9645:Myom1'
ID 726252
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Name myomesin 1
Synonyms skelemin, D430047A17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9645 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 71019521-71126856 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 71092209 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1120 (R1120H)
Ref Sequence ENSEMBL: ENSMUSP00000072945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
AlphaFold Q62234
PDB Structure Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]
Predicted Effect
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: R1022H

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073211
AA Change: R1120H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: R1120H

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
AA Change: R1022H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: R1022H

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik A G 9: 51,318,279 probably null Het
A430033K04Rik T C 5: 138,646,531 V226A probably benign Het
Acan G T 7: 79,099,905 V1475F probably benign Het
Acin1 T A 14: 54,664,456 R626S probably benign Het
Aff3 T C 1: 38,210,040 K662R probably damaging Het
Ankrd11 C T 8: 122,890,943 A2057T probably benign Het
Ano9 T G 7: 141,107,475 N309T probably benign Het
Ap3d1 G A 10: 80,709,228 S1092L probably benign Het
B4galt7 C T 13: 55,608,743 H257Y probably damaging Het
BC051665 G T 13: 60,784,731 Q47K possibly damaging Het
Brip1 A G 11: 86,061,686 F1090L probably benign Het
Cabin1 A G 10: 75,658,709 V1612A probably benign Het
Ccar1 A T 10: 62,766,590 D434E probably benign Het
Ccdc15 T C 9: 37,315,787 D297G probably benign Het
Celsr3 C A 9: 108,827,492 Y391* probably null Het
Cfap52 A G 11: 67,946,353 I194T possibly damaging Het
Ctif T C 18: 75,624,281 E67G probably benign Het
Cxcr6 T C 9: 123,810,086 F58L possibly damaging Het
Cyp2c69 T C 19: 39,881,149 E142G probably damaging Het
Ddx58 T C 4: 40,220,437 E482G possibly damaging Het
Dnah6 T A 6: 73,138,767 R1549S possibly damaging Het
Duxf3 A T 10: 58,230,981 H75Q probably benign Het
Ehbp1 A T 11: 22,101,052 I500N probably damaging Het
F13a1 A T 13: 36,898,180 S517T probably benign Het
Fbln7 C T 2: 128,877,396 R38C probably damaging Het
Fn1 T C 1: 71,628,470 N788S probably benign Het
Foxc1 A T 13: 31,807,899 E231V probably damaging Het
Gal3st2b T C 1: 93,938,606 S10P probably damaging Het
Gm6899 G A 11: 26,593,592 C53Y unknown Het
Hps3 T C 3: 20,030,667 E119G probably benign Het
Impg2 A G 16: 56,218,404 E135G probably damaging Het
Kalrn G A 16: 34,212,213 T1155M probably benign Het
Kcna6 G A 6: 126,739,059 A289V probably benign Het
Kcnh5 T C 12: 75,087,417 M453V probably benign Het
Krt222 A G 11: 99,240,494 V75A possibly damaging Het
Lmtk3 A T 7: 45,801,007 T1432S unknown Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltbp3 C G 19: 5,752,071 N758K probably damaging Het
Map6d1 T A 16: 20,236,627 H153L possibly damaging Het
Mefv A G 16: 3,710,918 L583P probably damaging Het
Mrps28 T C 3: 8,802,329 T160A probably damaging Het
Muc6 T C 7: 141,637,870 T2297A possibly damaging Het
Mx1 G T 16: 97,452,209 D338E probably benign Het
Nif3l1 T C 1: 58,447,915 F87L probably benign Het
Olfr1184 T C 2: 88,487,029 V99A possibly damaging Het
Olfr395 T A 11: 73,906,887 M202L probably benign Het
Pex10 T A 4: 155,068,807 L111Q probably damaging Het
Phf1 T C 17: 26,935,156 probably null Het
Pigp A T 16: 94,365,419 Y143* probably null Het
Prrc2a A G 17: 35,162,200 probably null Het
Psd GCC GC 19: 46,313,402 probably null Het
Pum3 A G 19: 27,426,012 S30P probably benign Het
Rab12 A G 17: 66,519,426 S97P probably damaging Het
Ros1 A G 10: 52,072,052 probably null Het
Scp2 A T 4: 108,091,322 Y197N probably benign Het
Serpinb10 T C 1: 107,546,758 F217L possibly damaging Het
Shank3 T G 15: 89,525,250 M604R possibly damaging Het
Slc22a29 A G 19: 8,207,124 S238P probably benign Het
Smarcc1 A G 9: 110,157,342 D237G probably damaging Het
Soga1 T C 2: 157,027,470 K1082E probably damaging Het
Stag3 T C 5: 138,301,439 S871P possibly damaging Het
Tmem132d A G 5: 128,269,011 F149S probably damaging Het
Tmem25 C T 9: 44,795,218 E333K Het
Togaram1 T A 12: 65,019,308 Y1695* probably null Het
Tox3 G A 8: 90,257,946 P202S probably damaging Het
Trim34b T A 7: 104,331,267 N187K probably benign Het
Vcan A G 13: 89,692,962 S1488P probably benign Het
Vps26a A C 10: 62,470,012 V124G probably benign Het
Vps50 T G 6: 3,516,706 S63A possibly damaging Het
Wbp4 T A 14: 79,470,113 E186V possibly damaging Het
Zfp52 A G 17: 21,561,675 D595G possibly damaging Het
Zfr2 C A 10: 81,248,418 S1* probably null Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 splice site probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 splice site probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
R7168:Myom1 UTSW 17 71089947 missense probably benign 0.00
R7286:Myom1 UTSW 17 71045549 missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71080897 critical splice donor site probably null
R7672:Myom1 UTSW 17 71084240 missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71117436 missense probably benign 0.03
R7898:Myom1 UTSW 17 71045752 missense probably benign 0.25
R8008:Myom1 UTSW 17 71100062 missense probably benign 0.30
R8152:Myom1 UTSW 17 71084295 missense probably damaging 0.96
R8554:Myom1 UTSW 17 71036453 missense possibly damaging 0.94
R8874:Myom1 UTSW 17 71106204 missense probably damaging 1.00
R8981:Myom1 UTSW 17 71084321 missense probably benign 0.09
R9012:Myom1 UTSW 17 71100108 missense probably benign 0.06
R9090:Myom1 UTSW 17 71067330 missense probably damaging 1.00
R9193:Myom1 UTSW 17 71036300 missense probably damaging 1.00
R9237:Myom1 UTSW 17 71101056 missense probably damaging 1.00
R9271:Myom1 UTSW 17 71067330 missense probably damaging 1.00
R9355:Myom1 UTSW 17 71077893 missense probably damaging 1.00
R9362:Myom1 UTSW 17 71036293 missense probably benign 0.00
R9440:Myom1 UTSW 17 71126334 missense probably benign 0.00
R9469:Myom1 UTSW 17 71061127 missense possibly damaging 0.79
R9568:Myom1 UTSW 17 71087481 missense probably damaging 1.00
R9612:Myom1 UTSW 17 71105480 nonsense probably null
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGCGTCCTGTCTAGTTAGGG -3'
(R):5'- TGACTTTCCCATGCTAAGGG -3'

Sequencing Primer
(F):5'- ACTGGGCATATGATCTTCGCAAG -3'
(R):5'- TTTGTTAACTACTCAGACAGCACC -3'
Posted On 2022-09-12