Incidental Mutation 'R9012:Myom1'
ID 685726
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Name myomesin 1
Synonyms skelemin, D430047A17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9012 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 71019521-71126856 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 71100108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1173 (D1173E)
Ref Sequence ENSEMBL: ENSMUSP00000072945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
AlphaFold Q62234
PDB Structure Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000024847
AA Change: D1075E

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: D1075E

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073211
AA Change: D1173E

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: D1173E

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
AA Change: D1075E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: D1075E

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A G 17: 25,947,711 L284P probably benign Het
Agt T C 8: 124,564,215 N118D probably benign Het
Apol8 T C 15: 77,750,124 D84G probably benign Het
Arl6ip5 T A 6: 97,210,877 D19E probably benign Het
B3gnt3 G T 8: 71,693,029 H232N probably damaging Het
Btbd10 T C 7: 113,322,757 K347R probably damaging Het
Capn5 C T 7: 98,164,843 probably benign Het
Ccdc181 C T 1: 164,282,493 R390W probably damaging Het
Cdc42bpa T C 1: 180,031,512 V93A Het
Clcn1 A G 6: 42,291,633 I191V possibly damaging Het
Coro1c T C 5: 113,850,676 D202G probably damaging Het
Cul9 A G 17: 46,543,521 I85T probably benign Het
Cyp2c55 C T 19: 39,042,116 T464I probably benign Het
Dlgap1 G A 17: 70,516,187 E56K possibly damaging Het
Dnajc6 T C 4: 101,612,959 F298L probably damaging Het
E130311K13Rik A T 3: 63,915,513 W237R probably damaging Het
Fes T A 7: 80,383,136 D287V possibly damaging Het
Fstl5 G T 3: 76,659,720 W557L probably damaging Het
Gad2 A G 2: 22,690,251 N555D possibly damaging Het
Gm10277 C T 11: 77,786,022 R41K unknown Het
Gm11639 G A 11: 104,820,521 probably null Het
Gm21834 T C 17: 57,742,167 E18G probably null Het
Hnrnpul2 T C 19: 8,824,465 F346L possibly damaging Het
Hspa4 A T 11: 53,268,575 V524E probably benign Het
Ikbke T C 1: 131,273,453 I207V probably damaging Het
Iqsec3 T C 6: 121,413,037 I492V unknown Het
Itsn1 C A 16: 91,848,961 F846L unknown Het
Ldhal6b A T 17: 5,417,667 Y331N probably damaging Het
Lrrc37a T G 11: 103,499,152 T1816P probably benign Het
Lzts1 C T 8: 69,140,898 R19H probably damaging Het
Maats1 T C 16: 38,301,973 E712G probably damaging Het
Mast4 T A 13: 102,798,098 T338S probably benign Het
Mst1r A G 9: 107,914,761 E832G probably benign Het
Nlrp9c T A 7: 26,375,308 I821F probably benign Het
Obscn T C 11: 59,130,597 K806E probably benign Het
Olfr1225 A G 2: 89,170,585 I209T possibly damaging Het
Olfr695 T C 7: 106,713,908 M258V probably benign Het
Olfr811 A C 10: 129,801,602 S308A probably benign Het
Palld T A 8: 61,720,663 S321C possibly damaging Het
Pank4 C A 4: 154,978,390 probably benign Het
Psg26 T A 7: 18,482,671 H81L probably benign Het
Ptprq C T 10: 107,653,550 E905K probably benign Het
Siglecg T A 7: 43,411,099 L301Q probably damaging Het
Slc25a15 A G 8: 22,377,862 W301R probably benign Het
Slco1b2 T A 6: 141,656,828 V169D probably damaging Het
Sned1 T C 1: 93,284,598 V1174A probably damaging Het
Sorl1 A G 9: 42,071,195 V363A probably damaging Het
Sppl3 C A 5: 115,088,928 P239T probably benign Het
Stox1 A T 10: 62,664,832 S650T probably benign Het
Tbc1d9b A G 11: 50,149,861 T402A probably benign Het
Tmem104 A T 11: 115,201,318 E84D probably benign Het
Tox4 T C 14: 52,285,751 V56A probably benign Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Treml2 A G 17: 48,308,062 T192A possibly damaging Het
Vmn2r110 T C 17: 20,583,365 D316G probably damaging Het
Vmn2r5 A T 3: 64,504,494 W218R probably damaging Het
Vwa3b A G 1: 37,085,310 S330G probably benign Het
Wdr81 A G 11: 75,449,145 V220A possibly damaging Het
Zbbx A G 3: 75,061,653 S504P possibly damaging Het
Zfp68 A T 5: 138,607,021 C347S probably damaging Het
Zfp936 T A 7: 43,189,992 C294* probably null Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 splice site probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 splice site probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
R7168:Myom1 UTSW 17 71089947 missense probably benign 0.00
R7286:Myom1 UTSW 17 71045549 missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71080897 critical splice donor site probably null
R7672:Myom1 UTSW 17 71084240 missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71117436 missense probably benign 0.03
R7898:Myom1 UTSW 17 71045752 missense probably benign 0.25
R8008:Myom1 UTSW 17 71100062 missense probably benign 0.30
R8152:Myom1 UTSW 17 71084295 missense probably damaging 0.96
R8554:Myom1 UTSW 17 71036453 missense possibly damaging 0.94
R8874:Myom1 UTSW 17 71106204 missense probably damaging 1.00
R8981:Myom1 UTSW 17 71084321 missense probably benign 0.09
R9090:Myom1 UTSW 17 71067330 missense probably damaging 1.00
R9193:Myom1 UTSW 17 71036300 missense probably damaging 1.00
R9237:Myom1 UTSW 17 71101056 missense probably damaging 1.00
R9271:Myom1 UTSW 17 71067330 missense probably damaging 1.00
R9355:Myom1 UTSW 17 71077893 missense probably damaging 1.00
R9362:Myom1 UTSW 17 71036293 missense probably benign 0.00
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CCTGAACACAAGAGCTCTTAGC -3'
(R):5'- ACTCCAAGAACTGCATTTGAAGG -3'

Sequencing Primer
(F):5'- GGGTTTATCACAAGTCCCAACTG -3'
(R):5'- CTGCATTTGAAGGATTATTTTAAGGC -3'
Posted On 2021-10-11