Mutagenetix > Incidental Mutations

Incidental Mutation 'R9012:Myom1'

685726

Institutional Source

Beutler Lab

Gene Symbol

Myom1

Ensembl Gene

ENSMUSG00000024049

Gene Name

myomesin 1

Synonyms

skelemin, D430047A17Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9012 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71019521-71126856 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 71100108 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1173 (D1173E)

Ref Sequence

ENSEMBL: ENSMUSP00000072945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]

AlphaFold

Q62234

PDB Structure

Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000024847
AA Change: D1075E

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: D1075E

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000073211
AA Change: D1173E

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: D1173E

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
low complexity region	857	870	N/A	INTRINSIC
FN3	916	1002	4.99e-11	SMART
FN3	1021	1106	2.04e-16	SMART
IG	1123	1208	3.1e0	SMART
IG_like	1231	1317	1.34e1	SMART
IG_like	1351	1417	4.79e0	SMART
IG_like	1454	1531	1.54e2	SMART
IGc2	1567	1635	2.05e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179759
AA Change: D1075E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: D1075E

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	A	G	17: 25,947,711	L284P	probably benign	Het
Agt	T	C	8: 124,564,215	N118D	probably benign	Het
Apol8	T	C	15: 77,750,124	D84G	probably benign	Het
Arl6ip5	T	A	6: 97,210,877	D19E	probably benign	Het
B3gnt3	G	T	8: 71,693,029	H232N	probably damaging	Het
Btbd10	T	C	7: 113,322,757	K347R	probably damaging	Het
Capn5	C	T	7: 98,164,843		probably benign	Het
Ccdc181	C	T	1: 164,282,493	R390W	probably damaging	Het
Cdc42bpa	T	C	1: 180,031,512	V93A		Het
Clcn1	A	G	6: 42,291,633	I191V	possibly damaging	Het
Coro1c	T	C	5: 113,850,676	D202G	probably damaging	Het
Cul9	A	G	17: 46,543,521	I85T	probably benign	Het
Cyp2c55	C	T	19: 39,042,116	T464I	probably benign	Het
Dlgap1	G	A	17: 70,516,187	E56K	possibly damaging	Het
Dnajc6	T	C	4: 101,612,959	F298L	probably damaging	Het
E130311K13Rik	A	T	3: 63,915,513	W237R	probably damaging	Het
Fes	T	A	7: 80,383,136	D287V	possibly damaging	Het
Fstl5	G	T	3: 76,659,720	W557L	probably damaging	Het
Gad2	A	G	2: 22,690,251	N555D	possibly damaging	Het
Gm10277	C	T	11: 77,786,022	R41K	unknown	Het
Gm11639	G	A	11: 104,820,521		probably null	Het
Gm21834	T	C	17: 57,742,167	E18G	probably null	Het
Hnrnpul2	T	C	19: 8,824,465	F346L	possibly damaging	Het
Hspa4	A	T	11: 53,268,575	V524E	probably benign	Het
Ikbke	T	C	1: 131,273,453	I207V	probably damaging	Het
Iqsec3	T	C	6: 121,413,037	I492V	unknown	Het
Itsn1	C	A	16: 91,848,961	F846L	unknown	Het
Ldhal6b	A	T	17: 5,417,667	Y331N	probably damaging	Het
Lrrc37a	T	G	11: 103,499,152	T1816P	probably benign	Het
Lzts1	C	T	8: 69,140,898	R19H	probably damaging	Het
Maats1	T	C	16: 38,301,973	E712G	probably damaging	Het
Mast4	T	A	13: 102,798,098	T338S	probably benign	Het
Mst1r	A	G	9: 107,914,761	E832G	probably benign	Het
Nlrp9c	T	A	7: 26,375,308	I821F	probably benign	Het
Obscn	T	C	11: 59,130,597	K806E	probably benign	Het
Olfr1225	A	G	2: 89,170,585	I209T	possibly damaging	Het
Olfr695	T	C	7: 106,713,908	M258V	probably benign	Het
Olfr811	A	C	10: 129,801,602	S308A	probably benign	Het
Palld	T	A	8: 61,720,663	S321C	possibly damaging	Het
Pank4	C	A	4: 154,978,390		probably benign	Het
Psg26	T	A	7: 18,482,671	H81L	probably benign	Het
Ptprq	C	T	10: 107,653,550	E905K	probably benign	Het
Siglecg	T	A	7: 43,411,099	L301Q	probably damaging	Het
Slc25a15	A	G	8: 22,377,862	W301R	probably benign	Het
Slco1b2	T	A	6: 141,656,828	V169D	probably damaging	Het
Sned1	T	C	1: 93,284,598	V1174A	probably damaging	Het
Sorl1	A	G	9: 42,071,195	V363A	probably damaging	Het
Sppl3	C	A	5: 115,088,928	P239T	probably benign	Het
Stox1	A	T	10: 62,664,832	S650T	probably benign	Het
Tbc1d9b	A	G	11: 50,149,861	T402A	probably benign	Het
Tmem104	A	T	11: 115,201,318	E84D	probably benign	Het
Tox4	T	C	14: 52,285,751	V56A	probably benign	Het
Trav7-6	A	G	14: 53,717,147	K65E	probably benign	Het
Treml2	A	G	17: 48,308,062	T192A	possibly damaging	Het
Vmn2r110	T	C	17: 20,583,365	D316G	probably damaging	Het
Vmn2r5	A	T	3: 64,504,494	W218R	probably damaging	Het
Vwa3b	A	G	1: 37,085,310	S330G	probably benign	Het
Wdr81	A	G	11: 75,449,145	V220A	possibly damaging	Het
Zbbx	A	G	3: 75,061,653	S504P	possibly damaging	Het
Zfp68	A	T	5: 138,607,021	C347S	probably damaging	Het
Zfp936	T	A	7: 43,189,992	C294*	probably null	Het

Other mutations in Myom1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Myom1	APN	17	71126098	missense	probably damaging	1.00
IGL00845:Myom1	APN	17	71084429	missense	probably damaging	1.00
IGL00904:Myom1	APN	17	71099949	splice site	probably benign
IGL00928:Myom1	APN	17	71089913	missense	probably damaging	1.00
IGL01025:Myom1	APN	17	71077917	missense	probably damaging	1.00
IGL01548:Myom1	APN	17	71101220	splice site	probably benign
IGL01588:Myom1	APN	17	71117437	missense	possibly damaging	0.94
IGL01614:Myom1	APN	17	71126178	missense	possibly damaging	0.46
IGL01618:Myom1	APN	17	71099993	missense	possibly damaging	0.87
IGL01619:Myom1	APN	17	71044476	splice site	probably benign
IGL01766:Myom1	APN	17	71077288	missense	probably damaging	1.00
IGL02105:Myom1	APN	17	71047716	splice site	probably benign
IGL02122:Myom1	APN	17	71092137	missense	probably damaging	1.00
IGL02184:Myom1	APN	17	71072137	missense	possibly damaging	0.93
IGL02260:Myom1	APN	17	71108315	nonsense	probably null
IGL02486:Myom1	APN	17	71099944	splice site	probably benign
IGL02501:Myom1	APN	17	71072081	critical splice acceptor site	probably null
IGL02642:Myom1	APN	17	71101098	missense	possibly damaging	0.90
IGL02677:Myom1	APN	17	71084349	missense	probably damaging	1.00
IGL02719:Myom1	APN	17	71106354	splice site	probably benign
IGL02945:Myom1	APN	17	71092093	splice site	probably benign
IGL03086:Myom1	APN	17	71108671	missense	probably damaging	1.00
IGL03218:Myom1	APN	17	71084316	missense	possibly damaging	0.46
R0107:Myom1	UTSW	17	71077365	missense	probably damaging	1.00
R0130:Myom1	UTSW	17	71045755	missense	probably damaging	0.98
R0133:Myom1	UTSW	17	71047787	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0352:Myom1	UTSW	17	71045749	missense	possibly damaging	0.72
R0396:Myom1	UTSW	17	71034693	missense	probably damaging	1.00
R0496:Myom1	UTSW	17	71084306	missense	probably damaging	1.00
R0506:Myom1	UTSW	17	71092220	splice site	probably benign
R0511:Myom1	UTSW	17	71084317	missense	probably benign	0.22
R0600:Myom1	UTSW	17	71120648	missense	possibly damaging	0.48
R0699:Myom1	UTSW	17	71067313	missense	probably damaging	0.98
R0791:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0792:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0963:Myom1	UTSW	17	71077767	missense	possibly damaging	0.74
R1324:Myom1	UTSW	17	71052719	missense	probably damaging	0.98
R2102:Myom1	UTSW	17	71101029	missense	probably damaging	1.00
R2158:Myom1	UTSW	17	71064597	missense	possibly damaging	0.83
R2336:Myom1	UTSW	17	71023194	missense	possibly damaging	0.53
R2351:Myom1	UTSW	17	71034579	missense	probably damaging	0.98
R2442:Myom1	UTSW	17	71110735	missense	probably damaging	1.00
R2483:Myom1	UTSW	17	71077812	missense	probably damaging	1.00
R2892:Myom1	UTSW	17	71034653	missense	probably damaging	1.00
R2897:Myom1	UTSW	17	71101220	splice site	probably benign
R3440:Myom1	UTSW	17	71045663	splice site	probably null
R3842:Myom1	UTSW	17	71045624	missense	probably damaging	1.00
R4249:Myom1	UTSW	17	71092140	missense	probably damaging	1.00
R4329:Myom1	UTSW	17	71036353	missense	probably damaging	1.00
R4594:Myom1	UTSW	17	71100074	missense	possibly damaging	0.73
R4873:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4875:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4876:Myom1	UTSW	17	71077410	missense	probably damaging	1.00
R5171:Myom1	UTSW	17	71099972	missense	possibly damaging	0.94
R5540:Myom1	UTSW	17	71109787	missense	probably damaging	1.00
R5882:Myom1	UTSW	17	71110722	missense	probably damaging	1.00
R5978:Myom1	UTSW	17	71117443	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6155:Myom1	UTSW	17	71108695	critical splice donor site	probably null
R6261:Myom1	UTSW	17	71126137	missense	probably damaging	1.00
R6284:Myom1	UTSW	17	71022892	nonsense	probably null
R6313:Myom1	UTSW	17	71082488	missense	probably benign
R6369:Myom1	UTSW	17	71101076	missense	probably damaging	1.00
R6545:Myom1	UTSW	17	71082305	missense	probably benign	0.00
R6738:Myom1	UTSW	17	71100398	splice site	probably null
R6933:Myom1	UTSW	17	71052671	missense	probably damaging	1.00
R7168:Myom1	UTSW	17	71089947	missense	probably benign	0.00
R7286:Myom1	UTSW	17	71045549	missense	possibly damaging	0.90
R7315:Myom1	UTSW	17	71080897	critical splice donor site	probably null
R7672:Myom1	UTSW	17	71084240	missense	possibly damaging	0.92
R7789:Myom1	UTSW	17	71117436	missense	probably benign	0.03
R7898:Myom1	UTSW	17	71045752	missense	probably benign	0.25
R8008:Myom1	UTSW	17	71100062	missense	probably benign	0.30
R8152:Myom1	UTSW	17	71084295	missense	probably damaging	0.96
R8554:Myom1	UTSW	17	71036453	missense	possibly damaging	0.94
R8874:Myom1	UTSW	17	71106204	missense	probably damaging	1.00
R8981:Myom1	UTSW	17	71084321	missense	probably benign	0.09
R9090:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9193:Myom1	UTSW	17	71036300	missense	probably damaging	1.00
R9237:Myom1	UTSW	17	71101056	missense	probably damaging	1.00
R9271:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9355:Myom1	UTSW	17	71077893	missense	probably damaging	1.00
R9362:Myom1	UTSW	17	71036293	missense	probably benign	0.00
X0019:Myom1	UTSW	17	71100071	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- CCTGAACACAAGAGCTCTTAGC -3'
(R):5'- ACTCCAAGAACTGCATTTGAAGG -3'

Sequencing Primer
(F):5'- GGGTTTATCACAAGTCCCAACTG -3'
(R):5'- CTGCATTTGAAGGATTATTTTAAGGC -3'

Posted On

2021-10-11