Mutagenetix > Incidental Mutation

Incidental Mutation 'R9667:Gpr158'

727818

Institutional Source

Beutler Lab

Gene Symbol

Gpr158

Ensembl Gene

ENSMUSG00000045967

Gene Name

G protein-coupled receptor 158

Synonyms

5330427M13Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9667 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

21367542-21830547 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21825243 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 700 (I700V)

Ref Sequence

ENSEMBL: ENSMUSP00000049708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055946]

AlphaFold

Q8C419

Predicted Effect

probably damaging
Transcript: ENSMUST00000055946
AA Change: I700V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: I700V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	110	125	N/A	INTRINSIC
SCOP:d1edmb_	313	359	5e-4	SMART
Blast:EGF	318	365	2e-27	BLAST
Pfam:7tm_3	426	669	1.2e-35	PFAM
low complexity region	840	863	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016D06Rik	T	A	8: 11,655,681	E142V	probably benign	Het
4930563M21Rik	G	A	9: 55,983,361	Q355*	probably null	Het
9030624J02Rik	G	A	7: 118,749,692		probably null	Het
Aacs	A	T	5: 125,503,627	N255I	possibly damaging	Het
Abcf2	A	G	5: 24,574,187	L121P	probably damaging	Het
Amigo1	A	G	3: 108,187,718	I178V	probably benign	Het
Ankrd13a	T	A	5: 114,795,732	N262K	probably damaging	Het
Apba2	A	G	7: 64,695,314	E84G	possibly damaging	Het
Arhgap35	A	T	7: 16,562,989	L717*	probably null	Het
Aspa	A	T	11: 73,308,799	C217*	probably null	Het
Atp5g3	A	G	2: 73,909,223	I91T	probably damaging	Het
Birc6	T	C	17: 74,697,425	M4763T	possibly damaging	Het
Cc2d2b	A	G	19: 40,765,483	Y150C	unknown	Het
Ccdc180	C	T	4: 45,920,861	Q936*	probably null	Het
Cdc42bpg	A	G	19: 6,320,085	E1103G	probably benign	Het
Cdca2	T	C	14: 67,677,554	Q752R	probably benign	Het
Ces1b	A	T	8: 93,065,009	S321T	probably benign	Het
Cfap70	A	T	14: 20,440,622		probably null	Het
Cpox	C	T	16: 58,670,621	T65I	possibly damaging	Het
Crocc	C	T	4: 141,021,677	E1606K	probably damaging	Het
Cryzl2	T	G	1: 157,488,468	M337R	probably benign	Het
Cyp4a29	C	A	4: 115,254,433	A469D	probably damaging	Het
Dnaaf1	T	A	8: 119,579,304	Y107N	possibly damaging	Het
Dpp6	T	A	5: 27,725,606	I812N	probably damaging	Het
Elovl5	A	G	9: 77,982,665	T253A	possibly damaging	Het
Fancd2	T	A	6: 113,553,756	L450*	probably null	Het
Fbxo31	C	T	8: 121,578,469	R96H	probably damaging	Het
Gls	A	T	1: 52,190,877		probably null	Het
Gm3045	G	A	13: 56,429,440	E134K	possibly damaging	Het
Gm6904	T	C	14: 59,244,791	N171S	probably benign	Het
H2-Aa	T	C	17: 34,283,321	I209V	probably benign	Het
Ifnar2	A	G	16: 91,388,096	D125G	probably benign	Het
Igsf8	C	A	1: 172,317,752	D278E	possibly damaging	Het
Inpp5d	T	C	1: 87,695,406	I407T	probably damaging	Het
Iqcd	A	G	5: 120,606,672	E355G	probably damaging	Het
Klra2	T	A	6: 131,242,873	D115V	probably benign	Het
Kmt2b	T	C	7: 30,588,359	E120G	unknown	Het
Lhx6	A	G	2: 36,090,967	I321T	possibly damaging	Het
Lmna	CAGCACGGTGCGTGAGC	CAGC	3: 88,482,550		probably null	Het
Lztr1	T	C	16: 17,509,136	Y37H	probably damaging	Het
Malrd1	A	T	2: 15,565,215		probably null	Het
Mtmr3	C	T	11: 4,520,890	V79I	probably damaging	Het
Nbr1	A	G	11: 101,560,435	I56M	possibly damaging	Het
Ncor2	C	T	5: 125,048,481	A580T	unknown	Het
Ndst3	A	G	3: 123,560,217	I601T	possibly damaging	Het
Nectin4	C	A	1: 171,382,597	P219Q	probably damaging	Het
Nfatc4	T	C	14: 55,829,507	V501A	probably benign	Het
Nisch	T	C	14: 31,173,689	T1015A	probably damaging	Het
Nr2c1	T	C	10: 94,181,617		probably null	Het
Nrg2	T	C	18: 36,032,377	E394G	probably benign	Het
Oas1e	A	G	5: 120,794,282	F99L	probably benign	Het
Oaz3	A	T	3: 94,434,528	Y178*	probably null	Het
Olfr395	A	G	11: 73,907,271	S74P	possibly damaging	Het
Olfr810	A	C	10: 129,791,153	S145R	probably damaging	Het
Pcdhb20	C	T	18: 37,504,786	H122Y	probably benign	Het
Pdcd2	T	A	17: 15,527,273	M1L	probably damaging	Het
Plcd1	C	A	9: 119,072,630	G609W	probably damaging	Het
Plscr3	T	C	11: 69,847,805	F98L	probably benign	Het
Ppp1r8	T	C	4: 132,843,096	N6S	probably benign	Het
Prpf38b	G	A	3: 108,911,543		probably benign	Het
Rin2	T	A	2: 145,860,282	N299K	possibly damaging	Het
Serpina1d	T	G	12: 103,768,040	T2P	probably benign	Het
Slc22a16	A	G	10: 40,585,129	D330G	probably benign	Het
Slit1	G	A	19: 41,743,393	Q6*	probably null	Het
Spag9	T	C	11: 93,996,293	V8A	possibly damaging	Het
Spsb3	C	T	17: 24,886,810	T44I	unknown	Het
Srrt	T	C	5: 137,297,470	Y563C	probably damaging	Het
Syne2	A	G	12: 75,880,177	D69G	probably damaging	Het
Tcf12	A	G	9: 71,885,161	V80A	probably benign	Het
Tdpoz3	G	A	3: 93,826,029	D4N	possibly damaging	Het
Tekt2	C	T	4: 126,323,651	R207H	probably damaging	Het
Tmem132d	G	A	5: 127,984,311	T409I	possibly damaging	Het
Tmem245	G	T	4: 56,947,119	T98K	probably damaging	Het
Tmem70	A	C	1: 16,665,435	E43A	probably benign	Het
Trim25	A	T	11: 89,016,362	I516F	probably damaging	Het
Trim3	G	A	7: 105,618,248	S308L	possibly damaging	Het
Ttll9	C	T	2: 152,990,069	R189*	probably null	Het
Ttpal	T	C	2: 163,607,676		probably null	Het
Ubl4b	A	T	3: 107,554,595	H116Q	probably benign	Het
Unc80	C	A	1: 66,612,128	T1544K	possibly damaging	Het
Usp2	T	C	9: 44,092,190		probably null	Het
Usp25	T	C	16: 77,077,235		probably null	Het
Vmn1r167	C	T	7: 23,505,565	V9I	probably benign	Het
Vmn2r87	A	G	10: 130,478,907	I270T	probably damaging	Het
Wdr24	A	G	17: 25,827,327	D515G	possibly damaging	Het
Wdr81	T	C	11: 75,450,824	T87A		Het
Zcchc14	A	T	8: 121,605,124	L500Q	unknown	Het
Zzef1	A	G	11: 72,867,960	T1242A	probably benign	Het

Other mutations in Gpr158

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Gpr158	APN	2	21368683	missense	probably damaging	1.00
IGL00469:Gpr158	APN	2	21746795	splice site	probably benign
IGL00706:Gpr158	APN	2	21746773	missense	probably damaging	1.00
IGL00780:Gpr158	APN	2	21826818	nonsense	probably null
IGL00885:Gpr158	APN	2	21649021	missense	probably damaging	1.00
IGL01339:Gpr158	APN	2	21369031	missense	possibly damaging	0.73
IGL01368:Gpr158	APN	2	21827098	missense	probably damaging	1.00
IGL02141:Gpr158	APN	2	21783290	missense	probably damaging	0.99
IGL02455:Gpr158	APN	2	21368700	missense	probably benign	0.00
IGL02554:Gpr158	APN	2	21826596	missense	probably benign
IGL02681:Gpr158	APN	2	21815630	missense	probably damaging	1.00
IGL02752:Gpr158	APN	2	21826827	missense	possibly damaging	0.95
IGL02756:Gpr158	APN	2	21827079	missense	possibly damaging	0.47
IGL03181:Gpr158	APN	2	21783161	missense	probably benign	0.02
IGL03258:Gpr158	APN	2	21825274	missense	probably damaging	1.00
IGL03386:Gpr158	APN	2	21826246	missense	probably damaging	1.00
PIT4810001:Gpr158	UTSW	2	21826871	missense	probably benign	0.01
R0071:Gpr158	UTSW	2	21810668	missense	probably benign	0.08
R0081:Gpr158	UTSW	2	21826717	missense	probably damaging	1.00
R0528:Gpr158	UTSW	2	21825208	missense	probably damaging	1.00
R0560:Gpr158	UTSW	2	21825274	missense	probably damaging	1.00
R0603:Gpr158	UTSW	2	21815669	missense	possibly damaging	0.67
R1560:Gpr158	UTSW	2	21826314	missense	probably damaging	1.00
R1561:Gpr158	UTSW	2	21815694	splice site	probably null
R1609:Gpr158	UTSW	2	21783293	missense	possibly damaging	0.61
R1741:Gpr158	UTSW	2	21827548	missense	probably benign	0.00
R1827:Gpr158	UTSW	2	21827318	missense	probably benign
R1854:Gpr158	UTSW	2	21369124	missense	probably damaging	1.00
R1871:Gpr158	UTSW	2	21815615	missense	probably damaging	1.00
R2151:Gpr158	UTSW	2	21827514	missense	possibly damaging	0.82
R2273:Gpr158	UTSW	2	21826863	missense	probably benign
R2275:Gpr158	UTSW	2	21826863	missense	probably benign
R3004:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R3151:Gpr158	UTSW	2	21576960	missense	possibly damaging	0.68
R3943:Gpr158	UTSW	2	21368559	missense	possibly damaging	0.65
R4238:Gpr158	UTSW	2	21368551	missense	probably damaging	1.00
R4379:Gpr158	UTSW	2	21825214	missense	probably damaging	1.00
R4381:Gpr158	UTSW	2	21827592	missense	probably damaging	1.00
R4464:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4467:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4496:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4506:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4530:Gpr158	UTSW	2	21369000	missense	probably benign	0.03
R4646:Gpr158	UTSW	2	21827053	missense	probably benign
R4798:Gpr158	UTSW	2	21783182	missense	probably damaging	1.00
R4882:Gpr158	UTSW	2	21825248	missense	probably damaging	0.98
R4943:Gpr158	UTSW	2	21827157	missense	probably damaging	1.00
R5334:Gpr158	UTSW	2	21827505	missense	probably benign	0.01
R5560:Gpr158	UTSW	2	21826290	missense	possibly damaging	0.67
R5600:Gpr158	UTSW	2	21827235	missense	probably benign
R5637:Gpr158	UTSW	2	21783272	missense	probably benign	0.00
R5701:Gpr158	UTSW	2	21746709	missense	probably damaging	1.00
R5744:Gpr158	UTSW	2	21368520	missense	probably damaging	1.00
R5911:Gpr158	UTSW	2	21369121	missense	possibly damaging	0.95
R5991:Gpr158	UTSW	2	21368508	missense	probably damaging	0.99
R6200:Gpr158	UTSW	2	21399416	missense	probably damaging	0.97
R6306:Gpr158	UTSW	2	21815611	missense	possibly damaging	0.84
R6324:Gpr158	UTSW	2	21810554	missense	probably damaging	1.00
R6384:Gpr158	UTSW	2	21826288	missense	probably damaging	1.00
R6698:Gpr158	UTSW	2	21827110	missense	probably damaging	1.00
R6997:Gpr158	UTSW	2	21648991	missense	possibly damaging	0.46
R7086:Gpr158	UTSW	2	21826575	missense	probably benign	0.01
R7175:Gpr158	UTSW	2	21368302	missense	probably benign	0.13
R7197:Gpr158	UTSW	2	21810601	missense	probably damaging	0.99
R7293:Gpr158	UTSW	2	21576939	missense	possibly damaging	0.47
R7427:Gpr158	UTSW	2	21827318	missense	probably benign
R7515:Gpr158	UTSW	2	21368281	missense	probably damaging	1.00
R7730:Gpr158	UTSW	2	21826347	missense	probably damaging	1.00
R8122:Gpr158	UTSW	2	21826863	missense	probably benign
R8311:Gpr158	UTSW	2	21368890	missense	probably benign	0.00
R8754:Gpr158	UTSW	2	21576882	missense	probably benign	0.00
R8782:Gpr158	UTSW	2	21399338	missense	probably damaging	1.00
R8792:Gpr158	UTSW	2	21553326	missense	probably damaging	1.00
R8842:Gpr158	UTSW	2	21576940	missense	possibly damaging	0.88
R9009:Gpr158	UTSW	2	21576949	missense	probably damaging	1.00
R9102:Gpr158	UTSW	2	21825267	missense	probably damaging	1.00
R9150:Gpr158	UTSW	2	21826440	missense	probably benign	0.17
R9254:Gpr158	UTSW	2	21368231	start gained	probably benign
R9317:Gpr158	UTSW	2	21827226	missense	probably benign
R9379:Gpr158	UTSW	2	21368231	start gained	probably benign
R9428:Gpr158	UTSW	2	21783161	missense	probably benign
R9497:Gpr158	UTSW	2	21827014	missense	probably benign	0.00
R9681:Gpr158	UTSW	2	21826504	missense	probably damaging	0.99
X0062:Gpr158	UTSW	2	21826369	missense	probably damaging	1.00
Z1176:Gpr158	UTSW	2	21810690	critical splice donor site	probably null
Z1177:Gpr158	UTSW	2	21827272	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- GAACCTTAGAAAATGCTGCACTG -3'
(R):5'- GTTGAGACAGTTTTGTGAAGCAC -3'

Sequencing Primer
(F):5'- AATGCTGCACTGTCTAGCAATGG -3'
(R):5'- GTGGTTCTTTCAGTCTCTCACAG -3'

Posted On

2022-10-06