Incidental Mutation 'R9667:Gpr158'
ID 727818
Institutional Source Beutler Lab
Gene Symbol Gpr158
Ensembl Gene ENSMUSG00000045967
Gene Name G protein-coupled receptor 158
Synonyms 5330427M13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9667 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 21367542-21830547 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21825243 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 700 (I700V)
Ref Sequence ENSEMBL: ENSMUSP00000049708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055946]
AlphaFold Q8C419
Predicted Effect probably damaging
Transcript: ENSMUST00000055946
AA Change: I700V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: I700V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 110 125 N/A INTRINSIC
SCOP:d1edmb_ 313 359 5e-4 SMART
Blast:EGF 318 365 2e-27 BLAST
Pfam:7tm_3 426 669 1.2e-35 PFAM
low complexity region 840 863 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,655,681 E142V probably benign Het
4930563M21Rik G A 9: 55,983,361 Q355* probably null Het
9030624J02Rik G A 7: 118,749,692 probably null Het
Aacs A T 5: 125,503,627 N255I possibly damaging Het
Abcf2 A G 5: 24,574,187 L121P probably damaging Het
Amigo1 A G 3: 108,187,718 I178V probably benign Het
Ankrd13a T A 5: 114,795,732 N262K probably damaging Het
Apba2 A G 7: 64,695,314 E84G possibly damaging Het
Arhgap35 A T 7: 16,562,989 L717* probably null Het
Aspa A T 11: 73,308,799 C217* probably null Het
Atp5g3 A G 2: 73,909,223 I91T probably damaging Het
Birc6 T C 17: 74,697,425 M4763T possibly damaging Het
Cc2d2b A G 19: 40,765,483 Y150C unknown Het
Ccdc180 C T 4: 45,920,861 Q936* probably null Het
Cdc42bpg A G 19: 6,320,085 E1103G probably benign Het
Cdca2 T C 14: 67,677,554 Q752R probably benign Het
Ces1b A T 8: 93,065,009 S321T probably benign Het
Cfap70 A T 14: 20,440,622 probably null Het
Cpox C T 16: 58,670,621 T65I possibly damaging Het
Crocc C T 4: 141,021,677 E1606K probably damaging Het
Cryzl2 T G 1: 157,488,468 M337R probably benign Het
Cyp4a29 C A 4: 115,254,433 A469D probably damaging Het
Dnaaf1 T A 8: 119,579,304 Y107N possibly damaging Het
Dpp6 T A 5: 27,725,606 I812N probably damaging Het
Elovl5 A G 9: 77,982,665 T253A possibly damaging Het
Fancd2 T A 6: 113,553,756 L450* probably null Het
Fbxo31 C T 8: 121,578,469 R96H probably damaging Het
Gls A T 1: 52,190,877 probably null Het
Gm3045 G A 13: 56,429,440 E134K possibly damaging Het
Gm6904 T C 14: 59,244,791 N171S probably benign Het
H2-Aa T C 17: 34,283,321 I209V probably benign Het
Ifnar2 A G 16: 91,388,096 D125G probably benign Het
Igsf8 C A 1: 172,317,752 D278E possibly damaging Het
Inpp5d T C 1: 87,695,406 I407T probably damaging Het
Iqcd A G 5: 120,606,672 E355G probably damaging Het
Klra2 T A 6: 131,242,873 D115V probably benign Het
Kmt2b T C 7: 30,588,359 E120G unknown Het
Lhx6 A G 2: 36,090,967 I321T possibly damaging Het
Lmna CAGCACGGTGCGTGAGC CAGC 3: 88,482,550 probably null Het
Lztr1 T C 16: 17,509,136 Y37H probably damaging Het
Malrd1 A T 2: 15,565,215 probably null Het
Mtmr3 C T 11: 4,520,890 V79I probably damaging Het
Nbr1 A G 11: 101,560,435 I56M possibly damaging Het
Ncor2 C T 5: 125,048,481 A580T unknown Het
Ndst3 A G 3: 123,560,217 I601T possibly damaging Het
Nectin4 C A 1: 171,382,597 P219Q probably damaging Het
Nfatc4 T C 14: 55,829,507 V501A probably benign Het
Nisch T C 14: 31,173,689 T1015A probably damaging Het
Nr2c1 T C 10: 94,181,617 probably null Het
Nrg2 T C 18: 36,032,377 E394G probably benign Het
Oas1e A G 5: 120,794,282 F99L probably benign Het
Oaz3 A T 3: 94,434,528 Y178* probably null Het
Olfr395 A G 11: 73,907,271 S74P possibly damaging Het
Olfr810 A C 10: 129,791,153 S145R probably damaging Het
Pcdhb20 C T 18: 37,504,786 H122Y probably benign Het
Pdcd2 T A 17: 15,527,273 M1L probably damaging Het
Plcd1 C A 9: 119,072,630 G609W probably damaging Het
Plscr3 T C 11: 69,847,805 F98L probably benign Het
Ppp1r8 T C 4: 132,843,096 N6S probably benign Het
Prpf38b G A 3: 108,911,543 probably benign Het
Rin2 T A 2: 145,860,282 N299K possibly damaging Het
Serpina1d T G 12: 103,768,040 T2P probably benign Het
Slc22a16 A G 10: 40,585,129 D330G probably benign Het
Slit1 G A 19: 41,743,393 Q6* probably null Het
Spag9 T C 11: 93,996,293 V8A possibly damaging Het
Spsb3 C T 17: 24,886,810 T44I unknown Het
Srrt T C 5: 137,297,470 Y563C probably damaging Het
Syne2 A G 12: 75,880,177 D69G probably damaging Het
Tcf12 A G 9: 71,885,161 V80A probably benign Het
Tdpoz3 G A 3: 93,826,029 D4N possibly damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tmem132d G A 5: 127,984,311 T409I possibly damaging Het
Tmem245 G T 4: 56,947,119 T98K probably damaging Het
Tmem70 A C 1: 16,665,435 E43A probably benign Het
Trim25 A T 11: 89,016,362 I516F probably damaging Het
Trim3 G A 7: 105,618,248 S308L possibly damaging Het
Ttll9 C T 2: 152,990,069 R189* probably null Het
Ttpal T C 2: 163,607,676 probably null Het
Ubl4b A T 3: 107,554,595 H116Q probably benign Het
Unc80 C A 1: 66,612,128 T1544K possibly damaging Het
Usp2 T C 9: 44,092,190 probably null Het
Usp25 T C 16: 77,077,235 probably null Het
Vmn1r167 C T 7: 23,505,565 V9I probably benign Het
Vmn2r87 A G 10: 130,478,907 I270T probably damaging Het
Wdr24 A G 17: 25,827,327 D515G possibly damaging Het
Wdr81 T C 11: 75,450,824 T87A Het
Zcchc14 A T 8: 121,605,124 L500Q unknown Het
Zzef1 A G 11: 72,867,960 T1242A probably benign Het
Other mutations in Gpr158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Gpr158 APN 2 21368683 missense probably damaging 1.00
IGL00469:Gpr158 APN 2 21746795 splice site probably benign
IGL00706:Gpr158 APN 2 21746773 missense probably damaging 1.00
IGL00780:Gpr158 APN 2 21826818 nonsense probably null
IGL00885:Gpr158 APN 2 21649021 missense probably damaging 1.00
IGL01339:Gpr158 APN 2 21369031 missense possibly damaging 0.73
IGL01368:Gpr158 APN 2 21827098 missense probably damaging 1.00
IGL02141:Gpr158 APN 2 21783290 missense probably damaging 0.99
IGL02455:Gpr158 APN 2 21368700 missense probably benign 0.00
IGL02554:Gpr158 APN 2 21826596 missense probably benign
IGL02681:Gpr158 APN 2 21815630 missense probably damaging 1.00
IGL02752:Gpr158 APN 2 21826827 missense possibly damaging 0.95
IGL02756:Gpr158 APN 2 21827079 missense possibly damaging 0.47
IGL03181:Gpr158 APN 2 21783161 missense probably benign 0.02
IGL03258:Gpr158 APN 2 21825274 missense probably damaging 1.00
IGL03386:Gpr158 APN 2 21826246 missense probably damaging 1.00
PIT4810001:Gpr158 UTSW 2 21826871 missense probably benign 0.01
R0071:Gpr158 UTSW 2 21810668 missense probably benign 0.08
R0081:Gpr158 UTSW 2 21826717 missense probably damaging 1.00
R0528:Gpr158 UTSW 2 21825208 missense probably damaging 1.00
R0560:Gpr158 UTSW 2 21825274 missense probably damaging 1.00
R0603:Gpr158 UTSW 2 21815669 missense possibly damaging 0.67
R1560:Gpr158 UTSW 2 21826314 missense probably damaging 1.00
R1561:Gpr158 UTSW 2 21815694 splice site probably null
R1609:Gpr158 UTSW 2 21783293 missense possibly damaging 0.61
R1741:Gpr158 UTSW 2 21827548 missense probably benign 0.00
R1827:Gpr158 UTSW 2 21827318 missense probably benign
R1854:Gpr158 UTSW 2 21369124 missense probably damaging 1.00
R1871:Gpr158 UTSW 2 21815615 missense probably damaging 1.00
R2151:Gpr158 UTSW 2 21827514 missense possibly damaging 0.82
R2273:Gpr158 UTSW 2 21826863 missense probably benign
R2275:Gpr158 UTSW 2 21826863 missense probably benign
R3004:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R3151:Gpr158 UTSW 2 21576960 missense possibly damaging 0.68
R3943:Gpr158 UTSW 2 21368559 missense possibly damaging 0.65
R4238:Gpr158 UTSW 2 21368551 missense probably damaging 1.00
R4379:Gpr158 UTSW 2 21825214 missense probably damaging 1.00
R4381:Gpr158 UTSW 2 21827592 missense probably damaging 1.00
R4464:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4467:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4496:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4506:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4530:Gpr158 UTSW 2 21369000 missense probably benign 0.03
R4646:Gpr158 UTSW 2 21827053 missense probably benign
R4798:Gpr158 UTSW 2 21783182 missense probably damaging 1.00
R4882:Gpr158 UTSW 2 21825248 missense probably damaging 0.98
R4943:Gpr158 UTSW 2 21827157 missense probably damaging 1.00
R5334:Gpr158 UTSW 2 21827505 missense probably benign 0.01
R5560:Gpr158 UTSW 2 21826290 missense possibly damaging 0.67
R5600:Gpr158 UTSW 2 21827235 missense probably benign
R5637:Gpr158 UTSW 2 21783272 missense probably benign 0.00
R5701:Gpr158 UTSW 2 21746709 missense probably damaging 1.00
R5744:Gpr158 UTSW 2 21368520 missense probably damaging 1.00
R5911:Gpr158 UTSW 2 21369121 missense possibly damaging 0.95
R5991:Gpr158 UTSW 2 21368508 missense probably damaging 0.99
R6200:Gpr158 UTSW 2 21399416 missense probably damaging 0.97
R6306:Gpr158 UTSW 2 21815611 missense possibly damaging 0.84
R6324:Gpr158 UTSW 2 21810554 missense probably damaging 1.00
R6384:Gpr158 UTSW 2 21826288 missense probably damaging 1.00
R6698:Gpr158 UTSW 2 21827110 missense probably damaging 1.00
R6997:Gpr158 UTSW 2 21648991 missense possibly damaging 0.46
R7086:Gpr158 UTSW 2 21826575 missense probably benign 0.01
R7175:Gpr158 UTSW 2 21368302 missense probably benign 0.13
R7197:Gpr158 UTSW 2 21810601 missense probably damaging 0.99
R7293:Gpr158 UTSW 2 21576939 missense possibly damaging 0.47
R7427:Gpr158 UTSW 2 21827318 missense probably benign
R7515:Gpr158 UTSW 2 21368281 missense probably damaging 1.00
R7730:Gpr158 UTSW 2 21826347 missense probably damaging 1.00
R8122:Gpr158 UTSW 2 21826863 missense probably benign
R8311:Gpr158 UTSW 2 21368890 missense probably benign 0.00
R8754:Gpr158 UTSW 2 21576882 missense probably benign 0.00
R8782:Gpr158 UTSW 2 21399338 missense probably damaging 1.00
R8792:Gpr158 UTSW 2 21553326 missense probably damaging 1.00
R8842:Gpr158 UTSW 2 21576940 missense possibly damaging 0.88
R9009:Gpr158 UTSW 2 21576949 missense probably damaging 1.00
R9102:Gpr158 UTSW 2 21825267 missense probably damaging 1.00
R9150:Gpr158 UTSW 2 21826440 missense probably benign 0.17
R9254:Gpr158 UTSW 2 21368231 start gained probably benign
R9317:Gpr158 UTSW 2 21827226 missense probably benign
R9379:Gpr158 UTSW 2 21368231 start gained probably benign
R9428:Gpr158 UTSW 2 21783161 missense probably benign
R9497:Gpr158 UTSW 2 21827014 missense probably benign 0.00
R9681:Gpr158 UTSW 2 21826504 missense probably damaging 0.99
X0062:Gpr158 UTSW 2 21826369 missense probably damaging 1.00
Z1176:Gpr158 UTSW 2 21810690 critical splice donor site probably null
Z1177:Gpr158 UTSW 2 21827272 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GAACCTTAGAAAATGCTGCACTG -3'
(R):5'- GTTGAGACAGTTTTGTGAAGCAC -3'

Sequencing Primer
(F):5'- AATGCTGCACTGTCTAGCAATGG -3'
(R):5'- GTGGTTCTTTCAGTCTCTCACAG -3'
Posted On 2022-10-06